SecReT4
Protein ID: 117919731
T4SS name [ID]Trb [304]
Gene symbol-
Locus tagShewana3_1283
StrainShewanella sp. ANA-3
Repliconchromosome 1 [GenBank: NC_008577] [Browse all T4SS(s) in this replicon]
Location [Strand]1494600..1494986 [+]
Productconjugal transfer protein TrbC
Component typeTrbC
UniProt IDA0KUP8
KEGG IDshn:Shewana3_1283
PDB IDNA
Domain hit(s) vs Pfam TrbC [PF04956], Evalue: 7.4e-25, Aligned region: 31..118
Protein Sequence: 128 a.a.     [Download]
>gi|117919731|ref|YP_868923.1| conjugal transfer protein TrbC [Shewanella sp. ANA-3]
MTHAHAFRFSVNPLPHLSGLMRLRSLARPAGQGLLLAALLLFLADTAQAAGSSMPWEGPLQSILESIQGP
VARIVAVIIIIATGLALAFGDTSGGFRKLIQIVFGLSIAFAASSFFLSFFSFSGGAVV
 
Nucleotide Sequence: 387 bp     [Download]
>gi|117918459|ref|NC_008577.1|:1494600-1494986 Shewanella sp. ANA-3 chromosome 1, complete sequence
ATGACACACGCCCATGCTTTCCGCTTTTCCGTAAATCCGCTTCCCCACCTGTCCGGTCTCATGCGGCTGC
GCAGCCTCGCGCGCCCTGCGGGGCAGGGGCTGCTGCTGGCCGCACTGCTGCTGTTCCTGGCGGATACGGC
GCAGGCCGCCGGTTCCTCGATGCCGTGGGAGGGGCCGTTGCAGTCGATCTTGGAGTCGATTCAGGGGCCG
GTCGCACGCATCGTCGCGGTCATCATCATCATCGCCACGGGCCTCGCGCTCGCCTTCGGCGACACGTCGG
GAGGCTTTCGCAAACTGATCCAGATCGTCTTCGGTCTGTCCATTGCGTTCGCCGCGTCCTCGTTCTTCCT
GTCGTTCTTCAGCTTCTCCGGCGGGGCCGTCGTATGA
 Primer design