SecReT4
Protein ID: 117919732
T4SS name [ID]Trb [304]
Gene symbol-
Locus tagShewana3_1284
StrainShewanella sp. ANA-3
Repliconchromosome 1 [GenBank: NC_008577] [Browse all T4SS(s) in this replicon]
Location [Strand]1494983..1495252 [+]
Productputative conjugal transfer trbD transmembrane protein
Component typeTrbD
UniProt IDA0KUP9
KEGG IDshn:Shewana3_1284
PDB IDNA
Domain hit(s) vs Pfam VirB3 [PF05101], Evalue: 1.3e-11, Aligned region: 1..82
Protein Sequence: 89 a.a.     [Download]
>gi|117919732|ref|YP_868924.1| putative conjugal transfer trbD transmembrane protein [Shewanella sp. ANA-3]
MSTANDLPGFEVPLHRSLTEPILLGGAPRTVAIANGTLAAAVGLGLQLWIPGVVLWIVGHSLAVWGARVD
PQFMQVFARHIKHKPLLDV
 
Nucleotide Sequence: 270 bp     [Download]
>gi|117918459|ref|NC_008577.1|:1494983-1495252 Shewanella sp. ANA-3 chromosome 1, complete sequence
ATGAGCACGGCCAACGATCTTCCCGGCTTCGAGGTGCCGCTGCATCGCTCGCTGACCGAGCCAATCCTGC
TTGGTGGTGCGCCGCGCACGGTCGCCATTGCGAACGGCACGCTGGCCGCCGCCGTGGGGCTGGGCCTGCA
ACTGTGGATTCCCGGCGTGGTGCTCTGGATCGTCGGCCATTCGCTGGCCGTATGGGGCGCGCGTGTCGAT
CCGCAGTTCATGCAGGTCTTCGCCCGGCACATCAAGCACAAGCCGCTGCTGGACGTGTGA
 Primer design