SecReT4
Protein ID: 121595231
T4SS name [ID]Trb [239]
Gene symbol-
Locus tagAjs_2910
StrainAcidovorax sp. JS42
Repliconchromosome [GenBank: NC_008782] [Browse all T4SS(s) in this replicon]
Location [Strand]3084659..3085036 [-]
Productconjugal transfer protein TrbC
Component typeTrbC
UniProt IDA1W9X6
KEGG IDajs:Ajs_2910
PDB IDNA
Domain hit(s) vs Pfam TrbC [PF04956], Evalue: 8.5e-25, Aligned region: 24..115
Protein Sequence: 125 a.a.     [Download]
>gi|121595231|ref|YP_987127.1| conjugal transfer protein TrbC [Acidovorax sp. JS42]
MTHADAFRISANPLPRPARLDGLARPAMQGLMLAALMLLLAGTAQAAGSSMPWEGPLQSILESIQGPVAR
IVAVIIIIATGLALAFGDTSGGFRKLIQIVFGLSIAFAASSFFLSFFSFSGGAVV
 
Nucleotide Sequence: 378 bp     [Download]
>gi|121592436|ref|NC_008782.1|:c3085036-3084659 Acidovorax sp. JS42 chromosome, complete genome
ATGACGCACGCTGATGCTTTCCGTATTTCCGCAAATCCGCTTCCTCGGCCCGCACGGCTGGATGGCCTGG
CTCGCCCGGCCATGCAGGGCTTGATGCTCGCGGCGCTGATGTTGCTGCTCGCAGGCACCGCGCAGGCCGC
GGGTTCCTCGATGCCCTGGGAAGGGCCGCTGCAATCCATCCTCGAATCCATCCAGGGGCCGGTGGCGCGC
ATCGTCGCGGTCATCATCATCATCGCCACGGGCTTGGCGCTGGCCTTCGGCGATACCTCGGGCGGGTTCC
GCAAGCTGATCCAGATCGTGTTTGGCCTGTCCATCGCGTTCGCCGCTTCGAGCTTCTTCCTGTCGTTCTT
CAGCTTCTCCGGTGGGGCCGTCGTATGA
 Primer design