SecReT4
Protein ID: 145597272
T4SS name [ID]Tra_F [118]
Gene symbol-
Locus tagYPDSF_4108
StrainYersinia pestis Pestoides F
Repliconplasmid MT [GenBank: NC_009378] [Browse all T4SS(s) in this replicon]
Location [Strand]88686..88934 [-]
Productconjugal transfer pilin chaperone TraQ
Component typeTraQ_F
UniProt IDA4TSZ7
KEGG IDypp:YPDSF_4108
PDB IDNA
Domain hit(s) vs Pfam TraQ [PF09679], Evalue: 5.9e-41, Aligned region: 1..81
Protein Sequence: 82 a.a.     [Download]
>gi|145597272|ref|YP_001154742.1| conjugal transfer pilin chaperone TraQ [Yersinia pestis Pestoides F]
MRKFRFRLPEFDVPGLWVLSLGIWFHIVSRLVRREPEMAILLAQIIGVSMVLWGGYRIINRWIDAAREAE
KARDAGGCRHEP
 
Nucleotide Sequence: 249 bp     [Download]
>ref|NC_009378.1|:c88934-88686 conjugal transfer pilin chaperone TraQ [Yersinia pestis Pestoides F]
ATGCGCAAATTCCGTTTTCGCCTGCCCGAGTTCGACGTGCCCGGATTATGGGTGCTGAGCCTCGGGATAT
GGTTTCACATTGTTTCCCGCCTGGTCCGGCGCGAGCCGGAGATGGCCATTCTTCTGGCGCAGATAATCGG
CGTATCGATGGTGCTCTGGGGGGGCTACCGCATTATCAACCGCTGGATTGATGCTGCCCGTGAGGCCGAA
AAGGCCCGTGATGCCGGAGGATGCCGACATGAACCTTAG
 Primer design