SecReT4
Protein ID: 148254785
T4SS name [ID]Trb [336]
Gene symboltrbC
Locus tagBBta_3365
StrainBradyrhizobium sp. BTAi1
Repliconchromosome [GenBank: NC_009485] [Browse all T4SS(s) in this replicon]
Location [Strand]3522425..3522754 [+]
Productconjugal transfer protein TrbC
Component typeTrbC
UniProt IDA5EH20
KEGG IDbbt:BBta_3365
PDB IDNA
Domain hit(s) vs Pfam TrbC [PF04956], Evalue: 1.6e-22, Aligned region: 1..99
Protein Sequence: 109 a.a.     [Download]
>gi|148254785|ref|YP_001239370.1| conjugal transfer protein TrbC [Bradyrhizobium sp. BTAi1]
MKQRSGLSAFGAVASSAVTLASFAMSPARAAGSNMPWEQPLNQILLSVQGPVAKILAVIIIISTGLTLAF
GDTSGGFRRLIQIVFGLSIAFAASSFFLAFFSFGGGAVI
 
Nucleotide Sequence: 330 bp     [Download]
>gi|148251626|ref|NC_009485.1|:3522425-3522754 Bradyrhizobium sp. BTAi1 chromosome, complete genome
ATGAAGCAACGCTCAGGTCTTTCCGCTTTTGGGGCGGTCGCGTCTTCGGCTGTGACTTTGGCGAGCTTTG
CGATGAGCCCGGCCCGCGCCGCGGGCTCCAACATGCCGTGGGAGCAGCCGCTCAATCAGATCCTGCTGTC
GGTCCAGGGACCTGTGGCGAAAATCCTGGCAGTCATCATCATCATCAGCACTGGCCTGACGCTCGCCTTC
GGCGACACGTCGGGAGGATTCCGCCGCCTGATCCAGATCGTCTTCGGGCTCTCGATCGCCTTTGCGGCCT
CGAGCTTCTTCCTGGCGTTCTTCTCGTTCGGTGGCGGGGCAGTGATCTGA
 Primer design