SecReT4
Protein ID: 157418132
T4SS name [ID]Tra_F [111]
Gene symboltraQ
Locus tagAPECO1_O1CoBM49
StrainEscherichia coli APEC O1
Repliconplasmid pAPEC-O1-ColBM [GenBank: NC_009837] [Browse all T4SS(s) in this replicon]
Location [Strand]34584..34820 [+]
Productconjugal transfer pilin chaperone TraQ
Component typeTraQ_F
UniProt IDQ27TH3
KEGG IDecv:APECO1_O1CoBM49
PDB IDNA
Domain hit(s) vs Pfam TraQ [PF09679], Evalue: 7e-41, Aligned region: 1..78
Protein Sequence: 78 a.a.     [Download]
>gi|157418132|ref|YP_001481204.1| conjugal transfer pilin chaperone TraQ [Escherichia coli APEC O1]
MWVFSLGVWFHIVARLVYSKPWMAFFLAELIAAILVLFGAYQVLDAWIARVSREEREALEARQQAMMAEQ
QEGGHVSH
 
Nucleotide Sequence: 237 bp     [Download]
>gi|157418083|ref|NC_009837.1|:34584-34820 Escherichia coli APEC O1 plasmid pAPEC-O1-ColBM, complete sequence
ATGTGGGTATTTTCCCTGGGTGTCTGGTTTCATATCGTCGCCCGTCTTGTTTACAGCAAACCCTGGATGG
CTTTTTTTCTGGCGGAGCTGATTGCGGCCATCCTTGTGCTGTTCGGCGCATACCAGGTGCTGGATGCATG
GATTGCCCGTGTCAGCCGGGAAGAGCGTGAGGCACTGGAAGCCAGGCAACAGGCCATGATGGCAGAGCAG
CAGGAGGGCGGACATGTCTCTCACTAA
 Primer design