SecReT4
T4SS ID376
StrainBrucella melitensis biovar Abortus 2308
Repliconchromosome II [Browse all T4SS(s) in this replicon]
AccessionNC_007624
Location56647..67080
NameVirB
Functioneffector translocation
ClassificationType IVA; Type P
experimental Experimental investigation has been performed on this T4SS.

T4SS components
ComponentVirB1VirB2VirB3VirB4VirB5VirB6VirB7VirB8VirB9
Number111111111
ComponentVirB10VirB11VirD4
Number110

The information of T4SS components from NC_007624
Click the image to have a larger view
#Locus tag (Gene)Coordinates [+/-], size (bp)Protein GIProductComponent
1BAB2_005552960..54363 [-], 140483269009amino acid transporter 
2BAB2_005654581..55732 [-], 115283269010hypothetical protein 
3BAB2_005755983..56501 [-], 51983269011outer membrane protein OprF 
4BAB2_005856647..57735 [-], 108983269012type II secretion system protein E  VirB11
5BAB2_005957716..58882 [-], 116783269013glutelin  VirB10
6BAB2_006058879..59748 [-], 87083269014Type IV secretion system CagX conjugation protein  VirB9
7BAB2_006159745..60464 [-], 72083269015virulence protein  VirB8
8BAB2_006260467..60640 [-], 17483269016type IV secretion system protein VirB7  VirB7
9BAB2_006360804..61847 [-], 104483269017hypothetical protein  VirB6
10BAB2_006462031..62747 [-], 71783269018type IV secretion system protein VirB5  VirB5
11BAB2_006562752..65247 [-], 249683269019shikimate kinase  VirB4
12BAB2_006665247..65597 [-], 35183269020type IV secretion system protein VirB3-like protein  VirB3
13BAB2_006765611..65928 [-], 31883269021type IV secretion system protein VirB2  VirB2
14BAB2_006866364..67080 [-], 71783269022SLT domain-containing protein  VirB1
15BAB2_006967584..68822 [-], 123983269023peptidoglycan binding domain-containing protein 
16BAB2_0070 (galU)69222..70115 [+], 89483269024UTP-glucose-1-phosphate uridylyltransferase 
17BAB2_007170168..71706 [-], 153983269025hypothetical protein 
 
flank Genes in the 5-Kb flanking regions if available, or non-essential genes in the T4SS gene cluster if any.

Download FASTA format files
Proteins        Genes

Effectors
BPE043, VceC, BPE275, RicA, VceA, BPE005, BPE123

The information of protein effectors
#Locus tag (Gene)Coordinates [+/-], size (bp)Protein GIProduct  *
1BAB1_1043 1004798..1009459 [-], 466282699875hypothetical protein  BPE043
2BAB1_1058 1018574..1019830 [-], 125782699888hypothetical protein  VceC
3BAB1_1275 1237345..1238106 [-], 76282700087rhomboid-like protein  BPE275
4BAB1_1279 1240034..1240561 [-], 52882700091hexapeptide repeat-containing transferase  RicA
5BAB1_1652 1596760..1597077 [+], 31882700429hypothetical protein  VceA
6BAB1_2005 1941656..1942117 [-], 46282700764cAMP-dependent protein kinase  BPE005
7BAB2_0123 121652..122113 [-], 46283269070hypothetical protein  BPE123

Download FASTA format files
Proteins        Genes
The information on regulatory element

virB operon
Transcription unit information
Transcription start site (nt)Transcription termination site (nt)Strand (+/-)Content
67107NA-virB1-virB11
Promoter information
The promoter ( or -35, -10 region) may contain or be located in the region of 67108..67537 (-).
Regulator information
RegulatorDescriptionBinding site-containing region / Function
HutCActivitorRegion: 67237..67308 (-)
5'- CGCATACCACTTGTATATAAGATTTTGTTAAAAAAGAATTTTCTAATAGAACCAA
TACAAGTGCCCCAAAAT -3'
IHF(subunit alpha)ActivitorRegion: 67246..67296 (-)
5'- GTATATAAGATTTTGTTAAAAAAGAATTTTCTAATAGAACCAATACAAGTG -3'
IHF(subunit beta)ActivitorRegion: 67246..67296 (-)
5'- GTATATAAGATTTTGTTAAAAAAGAATTTTCTAATAGAACCAATACAAGTG -3'
MdrAActivitorRegion: 67237..67308 (-)
5'- CGCATACCACTTGTATATAAGATTTTGTTAAAAAAGAATTTTCTAATAGAACCAA
TACAAGTGCCCCAAAAT -3'
MdrAActivitorRegion: 67393..67460 (-)
5'- GATGCCGCCTAATGGAGCAAGTTCGGTAAAAATTTAGCCAGCTTGGATGTCTGCC
AATTATGTAGAGC -3'
VjbRBind to virB1-virB2 intergenic regionRegion: 66230..66247 (-)
5'- ATCTGCGATCTGGAGCAT -3'
VjbRActivitorRegion: 67135..67152 (-)
5'- ATGACCGATATCGCTGAT -3'
VjbRActivitorRegion: 67184..67225 (-)
5'- GTCATTCACACAATATATAGCCCCCTCACAAGCATATTTGTC -3'


(1) Sieira R; Arocena GM; Zorreguieta A; Comerci DJ; Ugalde RA (2012). A MarR-type regulator directly activates transcription from the Brucella abortus virB promoter by sharing a redundant role with HutC. J Bacteriol. . [PudMed:23002224] experimental
(2) Sa JC; Silva TM; Costa EA; Silva AP; Tsolis RM; Paixao TA; Carvalho Neta AV; Santos RL (2012). The virB-encoded type IV secretion system is critical for establishment of infection and persistence of Brucella ovis infection in mice. Vet Microbiol. . [PudMed:22483850] experimental
(3) de Jong MF; Tsolis RM (2012). Brucellosis and type IV secretion. Future Microbiol. 7(1):47-58. [PudMed:22191446]
(4) Caswell CC; Gaines JM; Roop RM 2nd (2012). The RNA chaperone Hfq independently coordinates expression of the VirB type IV secretion system and the LuxR-type regulator BabR in Brucella abortus 2308. J Bacteriol. 194(1):3-14. [PudMed:22020650] experimental
(5) Paschos A; den Hartigh A; Smith MA; Atluri VL; Sivanesan D; Tsolis RM; Baron C (2011). An in vivo high-throughput screening approach targeting the type IV secretion system component VirB8 identified inhibitors of Brucella abortus 2308 proliferation. Infect Immun. 79(3):1033-43. [PudMed:21173315] experimental
(6) Martinez-Nunez C; Altamirano-Silva P; Alvarado-Guillen F; Moreno E; Guzman-Verri C; Chaves-Olarte E (2010). The two-component system BvrR/BvrS regulates the expression of the type IV secretion system VirB in Brucella abortus. J Bacteriol. 192(21):5603-8. [PudMed:20833814] experimental
(7) Arocena GM; Sieira R; Comerci DJ; Ugalde RA (2010). Identification of the quorum-sensing target DNA sequence and N-Acyl homoserine lactone responsiveness of the Brucella abortus virB promoter. J Bacteriol. 192(13):3434-40. [PudMed:20400542] experimental
(8) Sieira R; Arocena GM; Bukata L; Comerci DJ; Ugalde RA (2010). Metabolic control of virulence genes in Brucella abortus: HutC coordinates virB expression and the histidine utilization pathway by direct binding to both promoters. J Bacteriol. 192(1):217-24. [PudMed:19854911] experimental
(9) Lapaque N; Muller A; Alexopoulou L; Howard JC; Gorvel JP (2009). Brucella abortus induces Irgm3 and Irga6 expression via type-I IFN by a MyD88-dependent pathway, without the requirement of TLR2, TLR4, TLR5 and TLR9. Microb Pathog. 47(6):299-304. [PudMed:19747534] experimental
(10) Rolan HG; Xavier MN; Santos RL; Tsolis RM (2009). Natural antibody contributes to host defense against an attenuated Brucella abortus virB mutant. Infect Immun. 77(7):3004-13. [PudMed:19364836] experimental
(11) Delpino MV; Fossati CA; Baldi PC (2009). Proinflammatory response of human osteoblastic cell lines and osteoblast-monocyte interaction upon infection with Brucella spp. Infect Immun. 77(3):984-95. [PudMed:19103778] experimental
(12) de Jong MF; Sun YH; den Hartigh AB; van Dijl JM; Tsolis RM (2008). Identification of VceA and VceC, two members of the VjbR regulon that are translocated into macrophages by the Brucella type IV secretion system. Mol Microbiol. 70(6):1378-96. [PudMed:19019140] experimental
(13) den Hartigh AB; Rolan HG; de Jong MF; Tsolis RM (2008). VirB3 to VirB6 and VirB8 to VirB11, but not VirB7, are essential for mediating persistence of Brucella in the reticuloendothelial system. J Bacteriol. 190(13):4427-36. [PudMed:18469100] experimental
(14) Rolan HG; Tsolis RM (2008). Inactivation of the type IV secretion system reduces the Th1 polarization of the immune response to Brucella abortus infection. Infect Immun. 76(7):3207-13. [PudMed:18458071] experimental
(15) Rolan HG; den Hartigh AB; Kahl-McDonagh M; Ficht T; Adams LG; Tsolis RM (2008). VirB12 is a serological marker of Brucella infection in experimental and natural hosts. Clin Vaccine Immunol. 15(2):208-14. [PudMed:18077620] experimental
(16) Roux CM; Rolan HG; Santos RL; Beremand PD; Thomas TL; Adams LG; Tsolis RM (2007). Brucella requires a functional Type IV secretion system to elicit innate immune responses in mice. Cell Microbiol. 9(7):1851-69. [PudMed:17441987] experimental
(17) Rolan HG; Tsolis RM (2007). Mice lacking components of adaptive immunity show increased Brucella abortus virB mutant colonization. Infect Immun. 75(6):2965-73. [PudMed:17420243] experimental
(18) Sun YH; Rolan HG; den Hartigh AB; Sondervan D; Tsolis RM (2005). Brucella abortus virB12 is expressed during infection but is not an essential component of the type IV secretion system. Infect Immun. 73(9):6048-54. [PudMed:16113325] experimental
(19) Celli J; Salcedo SP; Gorvel JP (2005). Brucella coopts the small GTPase Sar1 for intracellular replication. Proc Natl Acad Sci U S A. 102(5):1673-8. [PudMed:15632218] experimental
(20) Sieira R; Comerci DJ; Pietrasanta LI; Ugalde RA (2004). Integration host factor is involved in transcriptional regulation of the Brucella abortus virB operon. Mol Microbiol. 54(3):808-22. [PudMed:15491369] experimental
(21) den Hartigh AB; Sun YH; Sondervan D; Heuvelmans N; Reinders MO; Ficht TA; Tsolis RM (2004). Differential requirements for VirB1 and VirB2 during Brucella abortus infection. Infect Immun. 72(9):5143-9. [PudMed:15322008] experimental
(22) Celli J; de Chastellier C; Franchini DM; Pizarro-Cerda J; Moreno E; Gorvel JP (2003). Brucella evades macrophage killing via VirB-dependent sustained interactions with the endoplasmic reticulum. J Exp Med. 198(4):545-56. [PudMed:12925673] experimental
(23) Rouot B; Alvarez-Martinez MT; Marius C; Menanteau P; Guilloteau L; Boigegrain RA; Zumbihl R; O'Callaghan D; Domke N; Baron C (2003). Production of the type IV secretion system differs among Brucella species as revealed with VirB5- and VirB8-specific antisera. Infect Immun. 71(3):1075-82. [PudMed:12595417] experimental
(24) Sanchez DO; Zandomeni RO; Cravero S; Verdun RE; Pierrou E; Faccio P; Diaz G; Lanzavecchia S; Aguero F; Frasch AC; Andersson SG; Rossetti OL; Grau O; Ugalde RA (2001). Gene discovery through genomic sequencing of Brucella abortus. Infect Immun. 69(2):865-8. [PudMed:11159979]
(25) Sieira R; Comerci DJ; Sanchez DO; Ugalde RA (2000). A homologue of an operon required for DNA transfer in Agrobacterium is required in Brucella abortus for virulence and intracellular multiplication. J Bacteriol. 182(17):4849-55. [PudMed:10940027] experimental
(26) Hong PC; Tsolis RM; Ficht TA (2000). Identification of genes required for chronic persistence of Brucella abortus in mice. Infect Immun. 68(7):4102-7. [PudMed:10858227] experimental
 
experimental This literature contains experimental investigation