SecReT4
T4SS ID8
StrainPlasmid F
Repliconplasmid F [Browse all T4SS(s) in this replicon]
AccessionNC_002483
Location65556..98709
NameTra_F
FunctionConjugation
ClassificationType IVA; Type F
experimental Experimental investigation has been performed on this T4SS.

T4SS components
ComponentTraA_FTraB_FTraC_FTraD_FTraE_FTraF_FTraG_FTraH_FTraI_F
Number111111111
ComponentTraK_FTraL_FTraM_FTraN_FTraQ_FTraU_FTraV_FTraW_FTraX_F
Number111111111
ComponentTraY_FTrbC_FOrf169_F
Number111

The information of T4SS components from NC_002483
Click the image to have a larger view
#Locus tag (Gene)Coordinates [+/-], size (bp)Protein GIProductComponent
1D616_p97097 (psiB)61551..61985 [+], 4359507776hypothetical protein 
2D616_p97098 (psiA)61982..62701 [+], 7209507777hypothetical protein 
3D616_p97102 (flmC)62918..63130 [+], 2139507778hypothetical protein 
4D616_p97103 (flmA)62976..63134 [+], 1599507779hypothetical protein 
5D616_p97004 (ygdA)63372..63689 [-], 3189507780hypothetical protein 
6D616_p97003 (ygeA)64032..64319 [+], 2889507781hypothetical protein 
7D616_p97002 (ygeB)64438..65259 [+], 8229507782hypothetical protein 
8D616_p97001 (ygfA)65556..66065 [-], 5109507783hypothetical protein  Orf169_F
9D616_p97066 (traM)66479..66862 [+], 3849507784hypothetical protein  TraM_F
10D616_p97072 (traJ)67049..67738 [+], 6909507785hypothetical protein 
11D616_p97057 (traY)67837..68232 [+], 3969507786hypothetical protein  TraY_F
12D616_p97080 (traA)68265..68630 [+], 3669507787prepropilin  TraA_F
13D616_p97069 (traL)68645..68956 [+], 3129507788hypothetical protein  TraL_F
14D616_p97074 (traE)68978..69544 [+], 5679507789hypothetical protein  TraE_F
15D616_p97071 (traK)69531..70259 [+], 7299507790hypothetical protein  TraK_F
16D616_p97076 (traB)70259..71686 [+], 14289507791hypothetical protein  TraB_F
17D616_p97064 (traP)71676..72266 [+], 5919507792hypothetical protein 
18D616_p97051 (trbD)72253..72450 [+], 1989507793hypothetical protein 
19D616_p97049 (trbG)72462..72713 [+], 2529507794hypothetical protein 
20D616_p97059 (traV)72710..73225 [+], 5169507795hypothetical protein  TraV_F
21D616_p97062 (traR)73360..73581 [+], 2229507796hypothetical protein 
22D616_p97075 (traC)73741..76368 [+], 26289507797hypothetical protein  TraC_F
23D616_p97048 (trbI)76365..76751 [+], 3879507798hypothetical protein 
24D616_p97058 (traW)76748..77380 [+], 6339507799hypothetical protein  TraW_F
25D616_p97061 (traU)77377..78369 [+], 9939507800hypothetical protein  TraU_F
26D616_p97053 (trbC)78378..79016 [+], 6399507801hypothetical protein  TrbC_F
27D616_p97065 (traN)79013..80821 [+], 18099507802hypothetical protein  TraN_F
28D616_p97050 (trbE)80845..81105 [+], 2619507803hypothetical protein 
29D616_p97073 (traF)81068..81841 [+], 7749507804hypothetical protein  TraF_F
30D616_p97055 (trbA)81857..82204 [+], 3489507805hypothetical protein 
31D616_p97107 (artA)82206..82520 [-], 3159507806hypothetical protein 
32D616_p97070 (traQ)82601..82885 [+], 2859507807hypothetical protein  TraQ_F
33D616_p97060 (trbB)82872..83417 [+], 5469507808hypothetical protein 
34D616_p97052 (trbJ)83347..83688 [+], 3429507809hypothetical protein 
35D616_p97056 (trbF)83675..84055 [+], 3819507810hypothetical protein 
36D616_p97078 (traH)84052..85428 [+], 13779507811hypothetical protein  TraH_F
37D616_p97079 (traG)85425..88241 [+], 28179507812hypothetical protein  TraG_F
38D616_p97068 (traS)88274..88795 [+], 5229507813surface exclusion protien 
39D616_p97067 (traT)88817..89551 [+], 7359507814surface exclusion protien 
40D616_p97082 (traD)89804..91957 [+], 21549507815hypothetical protein  TraD_F
41D616_p97054 (trbH)91957..92676 [+], 7209507816hypothetical protein 
42D616_p97077 (traI)92673..97943 [+], 52719507817hypothetical protein  TraI_F
43D616_p97063 (traX)97963..98709 [+], 7479507818hypothetical protein  TraX_F
 
flank Genes in the 5-Kb flanking regions if available, or non-essential genes in the T4SS gene cluster if any.

Download FASTA format files
Proteins        Genes
The information on regulatory element

tra operon
Transcription unit information
Transcription start site (nt)Transcription termination site (nt)Strand (+/-)Content
NA97945+traY-traI
Promoter information
The promoter ( or -35, -10 region) may contain or be located in the region of 67772..67800 (+).Coordinate information is from NCBI
Regulator information
RegulatorDescriptionBinding site-containing region / Function
FISCan be activitor or repressorFIS can be both a repressor and activator depending on whether it acts alone or in competition with H-NS
H-NSRepressorSilencer of transcription
IHF(subunit alpha)ActivitorNA
IHF(subunit beta)ActivitorNA
SfrA/ArcAActivitorRegion: 67734..67763 (+)
5'- GTTAATAAGGTGTTAATAAAATATAGACTT -3'
TraJActivitorNA
TraY_FCan be activitor or repressorRegion: 67808..67832 (-)
5'- ACCTCCCGCTGTTTATCTTCTGGTT -3'
TraY_FCan be activitor or repressorRegion: 67810..67836 (+)
5'- CCAGAAGATAAACAGCGGGAGGTGTTA -3'


traM transcript
Transcription unit information
Transcription start site (nt)Transcription termination site (nt)Strand (+/-)Content
NA66987+traM
Promoter information
The promoter ( or -35, -10 region) may contain or be located in the region of 66340..66476 (+).This region has two promoters. The later border may be beyond the real promoter region
Regulator information
RegulatorDescriptionBinding site-containing region / Function
HfqRepressorRepress TraM synthesis by destabilizing its mRNA
H-NSRepressorSilencer of transcription
TraM_FRepressorRegion: 66343..66359 (+)
5'- GGGTGCTGCTAGCGGCG -3'
TraM_FRepressorRegion: 66383..66405 (+)
5'- CGCTAGGGGCGCTGCTAGCGGTG -3'
TraY_FActivitorTraY has a stimulatory effect on the promoter for the traM gene (Pm) whereas transcripts from Pm readthrough into traJ, stimulating further expression.


traJ transcript
Transcription unit information
Transcription start site (nt)Transcription termination site (nt)Strand (+/-)Content
6694467776+traJ
Promoter information
The promoter ( or -35, -10 region) may contain or be located in the region of 66911..66943 (+).Coordinate information is from NCBI
Regulator information
RegulatorDescriptionBinding site-containing region / Function
CRPActivitorRegion: 66866..66887 (+)
5'- AAATTTGACTTCGTTCAAATAT -3'
FinO (Interrupted gene)RNA chaperoneBind stem–loop structures in both FinP and traJ RNAs
FinP (RNA)RepressorFinP is complementary to the 5′ untranslated region of traJ mRNA and is believed to block ribosomal entry when associated with this mRNA
GroELRepressorGroEL is involved in negative regulation after heat shock by promoting proteolytic degradation of the activator protein TraJ
HfqRepressorRepress TraJ synthesis by destabilizing it mRNA protein
H-NSRepressorSilencer of transcription
HslURepressorATPase component of HslUV protease. HslVU (ClpYQ) is an AAA+ ATPase, degrades TraJ when stimulated by the CpxAR stress response system
HslVRepressorPeptidase component of the HslUV protease. HslVU (ClpYQ) is an AAA+ ATPase, degrades TraJ when stimulated by the CpxAR stress response system
LrpActivitorRegion: 66828..66843 (+)
5'- TGGAACGATTTTTTCC -3'
LrpActivitorRegion: 66888..66902 (+)
5'- CAGAGTTTTTATGAT -3'


(1) Frost LS; Koraimann G (2010). Regulation of bacterial conjugation: balancing opportunity with adversity. Future Microbiol. 5(7):1057-71. [PudMed:20632805]
(2) Dorman CJ (2009). Nucleoid-associated proteins and bacterial physiology. Adv Appl Microbiol. 67:47-64. [PudMed:19245936] experimental
(3) Audette GF; Manchak J; Beatty P; Klimke WA; Frost LS (2007). Entry exclusion in F-like plasmids requires intact TraG in the donor that recognizes its cognate TraS in the recipient. Microbiology. 153(Pt 2):442-51. [PudMed:17259615] experimental
(4) Haft RJ; Palacios G; Nguyen T; Mally M; Gachelet EG; Zechner EL; Traxler B (2006). General mutagenesis of F plasmid TraI reveals its role in conjugative regulation. J Bacteriol. 188(17):6346-53. [PudMed:16923902] experimental
(5) Will WR; Frost LS (2006). Characterization of the opposing roles of H-NS and TraJ in transcriptional regulation of the F-plasmid tra operon. J Bacteriol. 188(2):507-14. [PudMed:16385041] experimental
(6) Will WR; Frost LS (2006). Hfq is a regulator of F-plasmid TraJ and TraM synthesis in Escherichia coli. J Bacteriol. 188(1):124-31. [PudMed:16352828] experimental
(7) Elton TC; Holland SJ; Frost LS; Hazes B (2005). F-like type IV secretion systems encode proteins with thioredoxin folds that are putative DsbC homologues. J Bacteriol. 187(24):8267-77. [PudMed:16321931] experimental
(8) Daehnel K; Harris R; Maddera L; Silverman P (2005). Fluorescence assays for F-pili and their application. Microbiology. 151(Pt 11):3541-8. [PudMed:16272377] experimental
(9) Klimke WA; Rypien CD; Klinger B; Kennedy RA; Rodriguez-Maillard JM; Frost LS (2005). The mating pair stabilization protein, TraN, of the F plasmid is an outer-membrane protein with two regions that are important for its function in conjugation. Microbiology. 151(Pt 11):3527-40. [PudMed:16272376] experimental
(10) Will WR; Lu J; Frost LS (2004). The role of H-NS in silencing F transfer gene expression during entry into stationary phase. Mol Microbiol. 54(3):769-82. [PudMed:15491366] experimental
(11) Harris RL; Silverman PM (2004). Tra proteins characteristic of F-like type IV secretion systems constitute an interaction group by yeast two-hybrid analysis. J Bacteriol. 186(16):5480-5. [PudMed:15292150] experimental
(12) Bidlack JE; Silverman PM (2004). An active type IV secretion system encoded by the F plasmid sensitizes Escherichia coli to bile salts. J Bacteriol. 186(16):5202-9. [PudMed:15292121] experimental
(13) Lawley TD; Klimke WA; Gubbins MJ; Frost LS (2003). F factor conjugation is a true type IV secretion system. FEMS Microbiol Lett. 224(1):1-15. [PudMed:12855161]
(14) Schroder G; Krause S; Zechner EL; Traxler B; Yeo HJ; Lurz R; Waksman G; Lanka E (2002). TraG-like proteins of DNA transfer systems and of the Helicobacter pylori type IV secretion system: inner membrane gate for exported substrates. J Bacteriol. 184(10):2767-79. [PudMed:11976307] experimental
(15) Penfold SS; Simon J; Frost LS (1996). Regulation of the expression of the traM gene of the F sex factor of Escherichia coli. Mol Microbiol. 20(3):549-58. [PudMed:8736534] experimental
(16) Nelson WC; Morton BS; Lahue EE; Matson SW (1993). Characterization of the Escherichia coli F factor traY gene product and its binding sites. J Bacteriol. 175(8):2221-8. [PudMed:8468282] experimental
(17) van Biesen T; Soderbom F; Wagner EG; Frost LS (1993). Structural and functional analyses of the FinP antisense RNA regulatory system of the F conjugative plasmid. Mol Microbiol. 10(1):35-43. [PudMed:7526120] experimental
(18) Fowler T; Taylor L; Thompson R (1983). The control region of the F plasmid transfer operon: DNA sequence of the traJ and traY genes and characterisation of the traY leads to Z promoter. Gene. 26(1):79-89. [PudMed:6368316] experimental
(19) Mullineaux P; Willetts N (1985). Promoters in the transfer region of plasmid F. Basic Life Sci. 30:605-14. [PudMed:3893413] experimental
(20) Gamas P; Caro L; Galas D; Chandler M (1987). Expression of F transfer functions depends on the Escherichia coli integration host factor. Mol Gen Genet. 207(2-3):302-5. [PudMed:3302598] experimental
(21) Silverman PM; Wickersham E; Harris R (1991). Regulation of the F plasmid traY promoter in Escherichia coli by host and plasmid factors. J Mol Biol. 218(1):119-28. [PudMed:2002497] experimental
(22) Silverman PM; Rother S; Gaudin H (1991). Arc and Sfr functions of the Escherichia coli K-12 arcA gene product are genetically and physiologically separable. J Bacteriol. 173(18):5648-52. [PudMed:1885542] experimental
 
experimental This literature contains experimental investigation