SecReT6
Protein ID: 114563528
SecReT6 ID146
T6SS typei5
Gene symbol-
Locus tagSfri_2358
StrainShewanella frigidimarina NCIMB 400
Repliconchromosome [GenBank: NC_008345] [Browse all T6SS(s) in this replicon]
Location [Strand]2808850..2809140 [-]
ProductPAAR repeat-containing protein
NotePAAR
UniProt IDQ080W2
KEGG IDsfr:Sfri_2358
PDB IDNA
Domain hit(s) vs Pfam PAAR_motif [PF05488], Evalue: 1.80E-22, Aligned region: 1..21
PAAR_motif [PF05488], Evalue: 1.80E-22, Aligned region: 20..88
DUF4150 [PF13665], Evalue: 1.20E-05, Aligned region: 30..50
DUF4150 [PF13665], Evalue: 1.20E-05, Aligned region: 58..89
Protein Sequence: 96 a.a.     [Download]
>gi|114563528|ref|YP_751041.1| PAAR repeat-containing protein [Shewanella frigidimarina NCIMB 400]
MGMPAATISCMHLCPKMNPGPVPHVGGPIVMGSGNVLIGSLPAARKGDKLICVGPPDTINAGSSSVLING
KPAARMGDGTAHGGKIIVGNPTVMIG
 
Nucleotide Sequence: 291 bp     [Download]
>gi|114561188|ref|NC_008345.1|:c2809140-2808850 Shewanella frigidimarina NCIMB 400 chromosome, complete genome
ATGGGAATGCCAGCAGCAACCATTTCGTGTATGCATCTTTGTCCGAAAATGAATCCCGGTCCCGTTCCAC
ATGTTGGTGGTCCCATTGTGATGGGCTCAGGTAATGTCCTTATTGGTTCGTTACCTGCAGCGCGCAAAGG
TGACAAGTTAATTTGTGTCGGCCCGCCTGATACCATTAATGCGGGGTCGAGTTCGGTACTGATTAACGGA
AAACCAGCCGCCAGAATGGGTGATGGTACCGCACATGGTGGAAAAATTATTGTGGGTAATCCAACAGTAA
TGATCGGTTAG
 Primer design