SecReT6
Protein ID: 161519729
SecReT6 ID240
T6SS typeN/A
Gene symbol-
Locus tagBmul_3180
StrainBurkholderia multivorans ATCC 17616
Repliconchromosome II [GenBank: NC_010086] [Browse all T6SS(s) in this replicon]
Location [Strand]34280..34534 [+]
Producthypothetical protein
NotePAAR
UniProt IDA9AKV0
KEGG IDbmj:BMULJ_05345, bmu:Bmul_3180
PDB IDNA
Domain hit(s) vs Pfam PAAR_motif [PF05488], Evalue: 1.20E-15, Aligned region: 9..77
Protein Sequence: 84 a.a.     [Download]
>gi|161519729|ref|YP_001583156.1| hypothetical protein Bmul_3180 [Burkholderia multivorans ATCC 17616]
MPARVATLGTLTTHGGAVTSASAGVAINGRPAACVGDAVSCPLHGAGVITNGGVGTINGRQIAHHGSGTS
CGATLVVSDDGPTV
 
Nucleotide Sequence: 255 bp     [Download]
>gi|161519706|ref|NC_010086.1|:34280-34534 Burkholderia multivorans ATCC 17616 chromosome 2, complete sequence
ATGCCAGCCCGCGTTGCAACCCTTGGCACATTGACCACCCACGGTGGCGCGGTCACATCAGCGAGCGCAG
GCGTCGCGATCAATGGACGTCCCGCGGCATGCGTCGGCGACGCGGTGTCATGTCCGCTACATGGCGCGGG
CGTCATCACCAACGGCGGCGTCGGCACGATCAACGGCCGCCAAATTGCCCATCACGGCAGCGGCACGAGT
TGCGGCGCGACGCTTGTCGTGTCCGACGACGGCCCGACAGTCTGA
 Primer design