SecReT6
Protein ID: 338214593
SecReT6 ID919
T6SS typeiii
Gene symbol-
Locus tagRunsl_5224
StrainRunella slithyformis DSM 1959
Repliconchromosome [GenBank: NC_015703] [Browse all T6SS(s) in this replicon]
Location [Strand]6072044..6072343 [+]
ProductPAAR repeat-containing protein
NotePAAR
UniProt IDF8EL28
KEGG IDrsi:Runsl_5224
PDB IDNA
Domain hit(s) vs Pfam PAAR_motif [PF05488], Evalue: 3.80E-20, Aligned region: 1..17
PAAR_motif [PF05488], Evalue: 3.80E-20, Aligned region: 24..92
DUF4150 [PF13665], Evalue: 7.40E-06, Aligned region: 9..53
DUF4150 [PF13665], Evalue: 7.40E-06, Aligned region: 60..85
Protein Sequence: 99 a.a.     [Download]
>gi|338214593|ref|YP_004658656.1| PAAR repeat-containing protein [Runella slithyformis DSM 19594]
MGKPAARVGDMHTCPMVTPGLPPIPHVGGPIAGPGVPSVLIGGMPAAHVGDTCICVGPPDSATMGSASVI
IGGTPAVRMGDMTAHGGIIAMGLPTVLIG
 
Nucleotide Sequence: 300 bp     [Download]
>gi|338209545|ref|NC_015703.1|:6072044-6072343 Runella slithyformis DSM 19594 chromosome, complete genome
ATGGGAAAACCCGCCGCCCGCGTGGGCGATATGCACACCTGCCCGATGGTCACTCCCGGATTGCCGCCTA
TACCGCACGTGGGCGGACCTATTGCGGGTCCCGGTGTACCCTCGGTCTTAATCGGCGGAATGCCCGCCGC
TCACGTAGGCGATACCTGCATATGTGTAGGTCCGCCCGATTCAGCGACCATGGGATCAGCCTCCGTGATC
ATCGGCGGCACGCCGGCAGTACGTATGGGCGATATGACCGCCCACGGGGGGATCATAGCGATGGGCCTGC
CTACGGTATTGATCGGCTGA
 Primer design