SecReT6
Protein ID: 347538953
SecReT6 ID459
T6SS typei4b
Gene symbol-
Locus tagNH8B_1133
StrainPseudogulbenkiania sp. NH8B
Repliconchromosome [GenBank: NC_016002] [Browse all T6SS(s) in this replicon]
Location [Strand]1161350..1161613 [+]
ProductPAAR motif-containing protein
NotePAAR
UniProt IDG2J0H4
KEGG IDpse:NH8B_1133
PDB IDNA
Domain hit(s) vs Pfam PAAR_motif [PF05488], Evalue: 9.00E-25, Aligned region: 5..79
Protein Sequence: 87 a.a.     [Download]
>gi|347538953|ref|YP_004846377.1| unnamed protein product [Pseudogulbenkiania sp. NH8B]
MKRVIRLGDPTSHGGTVVSAASSTVLFGKPVALLGDQVTCPQQGHSNCTIVEGDSSWLVGGKPVALEGHK
VSCGATLIATLPELGKG
 
Nucleotide Sequence: 264 bp     [Download]
>gi|347537839|ref|NC_016002.1|:1161350-1161613 Pseudogulbenkiania sp. NH8B, complete genome
ATGAAACGCGTCATTCGCCTGGGGGACCCGACCAGCCACGGCGGCACGGTGGTGAGCGCCGCCTCCAGCA
CGGTGCTGTTCGGCAAGCCGGTGGCCTTGCTGGGCGATCAGGTCACCTGCCCGCAGCAGGGGCACAGCAA
CTGCACCATCGTGGAGGGCGACAGTAGCTGGCTGGTCGGCGGCAAGCCGGTGGCGCTGGAAGGCCACAAG
GTCAGCTGCGGCGCCACGCTGATCGCCACCCTGCCGGAGTTGGGCAAGGGCTAG
 Primer design