SecReT6
Protein ID: 403521399
SecReT6 ID694
T6SS typei3
Gene symbol-
Locus tagBPC006_II0105
StrainBurkholderia pseudomallei BPC006
Repliconchromosome II [GenBank: NC_018529] [Browse all T6SS(s) in this replicon]
Location [Strand]95080..95343 [+]
ProductPAAR motif-containing protein
NotePAAR
UniProt IDK7PXK4
KEGG IDbpq:BPC006_II0105
PDB IDNA
Domain hit(s) vs Pfam PAAR_motif [PF05488], Evalue: 4.30E-22, Aligned region: 5..80
Protein Sequence: 87 a.a.     [Download]
>gi|403521399|ref|YP_006656968.1| PAAR motif-containing protein [Burkholderia pseudomallei BPC006]
MRGVIRIGDSTSHGGRVETGREGSTVMGRAVACVGDRCTCPMNGHEHCVIVEGDEDVRIEGRAVAFDGHR
TSCGATLVSSIPTSGRV
 
Nucleotide Sequence: 264 bp     [Download]
>gi|403521294|ref|NC_018529.1|:95080-95343 Burkholderia pseudomallei BPC006 chromosome II, complete sequence
ATGCGTGGCGTGATTCGCATCGGCGATTCGACCTCGCACGGCGGCCGCGTCGAAACGGGCCGCGAAGGCT
CGACCGTGATGGGGCGGGCAGTGGCCTGCGTCGGCGACCGCTGCACGTGCCCGATGAATGGACACGAACA
TTGCGTGATCGTGGAGGGCGACGAAGACGTACGAATCGAGGGGCGTGCGGTGGCATTCGACGGCCATCGG
ACGTCGTGCGGCGCGACGCTCGTCTCGTCCATTCCGACATCGGGGCGCGTGTGA
 Primer design