SecReT6
Protein ID: 470170153
SecReT6 ID736
T6SS typei4b
Gene symbol-
Locus tagAZKH_1750
StrainAzoarcus sp. KH32C
Repliconchromosome [GenBank: NC_020516] [Browse all T6SS(s) in this replicon]
Location [Strand]1960600..1960866 [-]
Producthypothetical protein
NotePAAR
UniProt IDH0PSC4
KEGG IDaza:AZKH_1750
PDB IDNA
Domain hit(s) vs Pfam PAAR_motif [PF05488], Evalue: 2.40E-25, Aligned region: 8..82
Protein Sequence: 88 a.a.     [Download]
>gi|470170153|ref|YP_007551039.1| hypothetical protein AZKH_1750 [Azoarcus sp. KH32C]
MSRPFILLGDKTSHGGVVISASESSDCDGKGIARLGDRVTCPKKGHGRVTTIVTGDLTALIDGRPAARHG
DKTACGATLIASQSLTTD
 
Nucleotide Sequence: 267 bp     [Download]
>gi|470168442|ref|NC_020516.1|:c1960866-1960600 Azoarcus sp. KH32C DNA, complete genome
ATGTCGCGCCCCTTCATTCTTCTCGGTGACAAGACCAGCCATGGCGGCGTCGTGATCAGCGCATCGGAAA
GCAGCGATTGCGATGGCAAGGGAATCGCCCGGCTCGGTGACCGGGTGACCTGCCCGAAGAAAGGACATGG
ACGAGTCACGACGATCGTGACGGGCGATCTGACGGCGCTGATCGACGGACGTCCGGCCGCACGTCATGGC
GACAAGACCGCGTGCGGCGCAACGCTGATCGCCAGCCAATCGCTGACCACCGACTAA
 Primer design