Summary Sequence Context  
1 homologue found:
Download sequences in FASTA format.

>SLG78|dndC|dndDB1028 Streptomyces lividans 1326
ATGAGCACCCCCAAGGCGGCGGCGCCTTTCCAGGACCGGCCCCTGGCAGAGATCGTCGAGGAGCTGACGG
AGGAGATCCGCGAGCTCTACGTCGCTGATGAGGTGCCGTGGGTGGTCGGGTACAGCGGCGGCAAGGACTC
CACCGCCGTCCTCCAACTGGTCTGGCTCGCGCTCAAGGACCTACCGGCCGAACAGCGCACGAAGCCGGTG
CATGTGATCAGCACGGACACCCTGGTGGAGAACCCCGTCGTCGCTGCATGGGTAGGCCAGTCCCTGGACA
CCATGCGCACCGCCGCGCAGGAACAGCAGCTGCCCATCGAGTCGCACAAACTGACCCCGGAGATCAAAGA
CACCTTCTGGGTCAGCCTGATCGGCAAGGGCTACCCTGCACCCCGCCCGAAGTTCCGGTGGTGCACCGAG
CGGTTGAAGATCAAGCCATCGAACGCCTTCATCCGGCGCGTCGTACGCCGGCACGGCGAGGCGATCCTCG
TACTGGGAATCCGCAAGGCCGAAAGCCAAGCACGGGCACGGGCGATGGCCCGGCACGAGAAGGGGCGGGT
CCGTGACCGGCTCTCACCCAACGGCAACCTCCCCAACTCCCTTGTCTACAGCCCCATCGAGGCGTGGTCG
ACCGAGGAGGTCTGGGCGTTCTTGATGCAATACCCCAATCCGTGGGGCCACAAGAACAAGGATCTGCTGA
CCATGTACCAGGGTGCGTCGGACGACTCTGAGTGCCCGCTGGTCGTCGACGACACCACCCCCTCGTGCGG
TGACAGCCGCTTCGGATGCTGGACCTGCACGCTGGTGGAGCAGGACAAGTCGATGACCGCCATGATCCGC
AACGACGACGAGAAGCAGTGGATGCGGCCGTTGCTCAAGCTCCGCAACGAGCTCGACGACGTCACCAAGG
AAGCTCAAACACGGGACTTCCGCCGCATGAACGGCAACGTGCAGCTGTTCGGCGACCGGCCCATCCCCGG
CCCATACAAGCAGTCCGCCCGCGAAGACTGGCTGCGCAAGCTCCTCGCCGCCCAAGCCCAGGTCCGCAAG
AAGGCACCCGAGCACGTGCGTAACATTGAGCTGATCTCGATGGCGGAGCTGCAGGAGATCCGGCGGATCT
GGGTCTTCGAGAAGCACGAAGTCGAGGACTCCCTGCCGCAGATCTACGAGCAGGCGACCGGCGAGAAGTT
CCCCGGACTGCCGCTCGACGAGCAGCTCGTCCTGGGCGCCGAGGAGATCGGCCTGCTCAAGGAGGCCTGC
GAGGACGATCCGATCCACTTCTCGATGACCCGTGAGCTCCTCGCGATCGAGCGCCAGTATCGAACCATGA
CCCGGCGGGCCGGCCTCTTCGAGGCCCTGGAGAAGGCGATCAAGAAGGGCTACTACGAGGACGCGGACGA
CGCGCTGCGGTTCGCCAAGCGGCTGCAGGAAATGCGCGAGAGCGACCCGACACAGACGACGGCGGACGAA
GAGATCACCACCGATGCACCTGCATAA