Summary Sequence Context  
1 homologue found:
Download sequences in FASTA format.

>Ent638_0470|dndD|dndDB1060 Enterobacter sp. 638
GTGTTAATTAAACAGCTGGTATTGCGTAATTTCCGTGTATTTAATGGTACTCATGTCATTGATTTGGCGC
CGAGAAAGCGCCAGAACGATGATAATTCGCGTCCGATAGTTCTTTTCGGTGGGCTTAACGGAGCAGGAAA
AACATCAATTCTGTCTGCAATCCGCCTGGCATTGTATGGTCGGTTAGCGTTTGGCCCAGCAACTCAACAA
CAAGAGTATGTTGAAGAACTCAGCGCATTAGTTCACAACGGCTCAACTACTGGTGAACGGCCAAGTGAAG
CGTCGATTGAACTTGTTTTCACCTACAACAAAGGCGGGCATGAAGCTGAATTTACCGTTACGCGCTCGTG
GAAAAAAGGGAAAAAGGATCAACTATCCCTCCAACAAGATGGCCAACTTCTTGAAGAGTTGGATTATGAT
CAATGCCAGGGATTTTTGAATGAATTAATTCCGCATGGAATTGCCGATTTGTTCTTCTTTGATGGTGAAA
AAATTGCAGAGCTCGCTGAAGATGACTCTGGAAATATTCTGCGTACAGCCGTACGTCGCTTGTTAGGTTT
AGATCTCATCTCGAAACTTCGTAATGATTTGATGATCTTTGTTAAGCGTCAGCAATCCAGCCAACTCGCA
GGCTCCCAACAACAAAAACTTGCTGAACTTGAAGAACAGGTTAAGCAGTTTGCTTTCCAGACAGAGCAGA
TTTTAGAAAAAGCTGATTTTGCTAAAATGCGAATTGATTTGCTATCAAAAGAAATCAACCGATATGAAGC
ACTTCTGAATGCGCAAGGTGGTGCATTTGCTCAAACAAAAGCACAAGAAAAACAGAAAGTTGATACTCTG
CTAAAAGAAAAAGATCGCCTTGAAAAAGCATTGCGCCATGAATGCGATAGCTCACTACCTTACGCTCTGG
CACCTAAGACTCTAGAGCGTTTGCTTGAGCAAATTAGTGCAGAGATACAAATTAAGCAGGCGGACAGTTT
TGAAAAGGAATTAACTCAATTTCTTACGCAGCTGAAAAATGATATTTCATTCCGCTCAGGAACTACTGGC
AAAATTGCTGCCGAAGCAATTGAAGATAATCTGAAAGATTACCTGGCAGGGAAACCCAAAGGTGAGCTGC
TGTTTGACATCTCAGAACGTGAAGCTGGGATGATCCAACAATCTATCGAGAAGGACAGCAAGAAAGCCTG
GCAGCGTTTTGATCTTTATCGTCACCAATTGGCTGAAGTTGAAGAGCAGCTTGAACAAGCCGCGGCAAAC
ATTGCTCGTGCCCCGGAAGATGATCAGCTTTTCGATATATTTGAAAAACTTCGTGAGCTTGACCGTAAAC
GCGAGAGTAAACGGCAGGAGTATCGCTCGCTGTTGGAAGAAGCAAAACAAACTAAGCAGCTGCAACTGGA
CTGTGCTCGTCAGGTACAAAAAACACACGATCTGGCACGTAATCAACATAACTCCGATAGTGCATTTAAT
AATGCCCAAGAAACAATCAACCTGCTTGACCGCTACAGTGAACTTTTAACTCAAGCAAGGGTGAAAACGC
TATCAGCGAATTTTGAAGGTGCTTACCGTAAATTAGCTCGTAAAGAGGATTTGCAGCTCAATGCACACAT
CAATCCTGAAACGTTTGATGTGGAATTAGTGGATGAAAACGCCTCAGTGATCAATCGCAAGCTACTCTCT
GCCGGAGAGAAACAGATCTATGCGATTGCGATTCTTGAGGCCCTGGCAAAAACTTCTGGTCGTGATTTGC
CGGTAATCATTGATACTCCACTGGGCCGTTTAGACTCTCAACATAGAGATAAACTGATTAACCACTACTT
CCCGTTTGCCAGCCATCAGGTAGTGCTGTTGTCTACAGATACAGAAGTGGATGAGCGTTATTTTGTCGAT
CAACTTCGAGATGACATATCTCATGCTTATGAGATAGTGTTCAATGCACATACGAAATCTTCCGCACTTA
AGCCAGGTTATTTCTGGGAATTAACTAAGGAGGCAATCTGA