Summary Sequence Alignment 16S rRNA Context  
4 homologues found:
Download sequences in FASTA format.

>VFMJ11_A0171|dndB|dndDB1086 Vibrio fischeri MJ11
ATGAACAATCACGAATCTGGTTATTGCTATTCATTTCCTGCGGTTAAAGGCATACAAGCAGGTAGACCAT
TCTACATAGCGACCTGCCCTCTACGTATTATTCCAAAGATTTTCAGTTATAACGAAGATGATGTACCACC
CGAGCTACGTGCTCAACGTACTCTAAATAAAACTAGAATCCCTGAAATGGTACGTTACCTTCTTGAAAAT
CCTACAGAATATGTATTCTCTGCTTTAACCGCTTCTGTAGGTGTAGATATCTCATTTAACGAGCATGAAG
GCGCACCTAATCTAGGTATTCTTCATATTCCTATGGATGCACAGATCTTAATCAATGACGGTCAACACAG
ACGTAAAGCGATAGAAGAAGCATTAAGAGAAAACCCAGATCTTGGACAAGATAACATTGCAGTACTCTTC
TTTATTGATGAAGGCTTAGATCGTAGTCAACAAATGTTCGCCGATCTAAATAAATATGCCGTAAAACCAA
GTCCATCACTGGGCACCTTGTATGACCATCGTGATGAAAGCTCAGAACTTGCTCGATTATTAGCGAGTTC
AGTTCAACCATTTATTGGTTTAACTGAAATGGAAAAATCAAATATTTCGCCAAAATCGAATAAGTTATTC
ACGTTAAGTAGTATCAAACAATCCACTCGCGCTCTTTTAAGTAAAGGGGCAAAAGACGGTTTTAACGATG
AAGAAAAAGCATTAGCTTCTGAGTATTGGCAAGAAGTAACAAAACACATCAAAGATTGGCAACTTGTTCT
AAAAAAAGAAGTATCTCCAGCTCAACTACGTCAAGAGTTCATTCATGCTCACGGCCTTGGGCTCCACGCT
TTAGGCTTACTAGGTAAACATTTACTTTGCCAAGAGCCAAATAATTGGAAAGAAAAGCTTTCTTTATTAT
CTGAAGTAGATTGGAGAAAAACGAATAAAGACTGGTTGCAGCGTAGTATGAACCACGGCAAGTTGAGTAA
ATCAACAACCAACATTCAGCTAACTACAAACGCATTAAAAATGAAGCTAGGGTTAACGCTAACTCCTGAA
GAACAAACGCTAGAGAAGCAATTATCATGA
>VFMJ11_A0170|dndC|dndDB1087 Vibrio fischeri MJ11
ATGATACATGACCTCCAACTAACGGAAGACCTTGCAGAAGAATATCAAGAGTTTATTAACACTGAAGACT
TCGCAAATCACAAATTAAGCCACTATGTAGCAGATGTTCAACGTGTTTATTGTGCAGATAATAGACCTTG
GGTGATCGGTTACAGTGGAGGTAAAGACTCCTCTGCTATCATGTCACTTGTTTATCTTGCTCTTCTTGGA
CTAAAAGAAGAAGACCGAACAAAACAAGTGTTTGTTGTTACTTCAGATACCCTAGTCGAAACGCCTGTTG
TGGTAAATCATATCAACGATTCACTCGCCGCTATTCAAACTGGTGCAAAACGTGATGGGTTACCTATTAC
TTGTCACAAGGTAGTACCTGAAGATGATCAAACATTTTGGTCAAGCTTACTCGGTAAAGGCTATCCTGCA
CCTACTCGTTCTTTCCGTTGGTGTACTGAAAGAATGAAAATTAATCCTGTTAGTGACTTCATTAAATCTA
AAGTTTCTCAATTTGATGAGGTTATTGTTGTACTTGGCTCTCGCAGTCAAGAGAGTGCTTCTCGTGCACA
AGTTATTGCTAAGCACAAAATTGACGGCTCACGTTTAGCTCGTCATACAACGCTAGCGAATGCCTTCATT
TTTACACCAATTGATACTTGGGGTGTCGATGACGTTTGGAAAATCTTACGTTTATGCCACTTAGTCACCA
AAGAAACACCTTATGGCACCAAAAACATTTGGAGCAATGACTACGATTTAGAATGGGAAAACCCATGGGG
TGGTAAAAACTTAACACTCTGGAATCTATATAAAGATTCATCAGGTCAGGGCGAATGTCCAATGGTAATT
GATGAAACAACACCTTCTTGTGGTAATTCTCGTTTTGGTTGTTGGACTTGTACCGTTGTTACGCGTGACC
GTGCAATGGAGAGTCTTATTCAAAATGGTGAAGAATGGATGGCTCCTCTTCTGGAGTTCCGAAATAAGTT
AGCAATGACAACGGATCCAGCGAACAAGGAAGAATACCGAAACCACAAACGTCGAACCGGTAAAGTAAGC
TACCAATACGCCAAAGAAGGTGAAGATATAGCTAGCGAGCGAAAGCACGTACCGGGCCCTTACTGGCTTA
AATACCGTCGCCAATGGCTTCGTGAACTTCTAGAACTAGATAAGAAGTTTAAAGCTGAAGGCCGAGAGAT
TGAGCTAATCACGGTGCCAGAGCTACATGCTATTCGTCAAGAATGGATCAAAGATCCAAATGAACCAGAC
TGGGATGACTCTCTACCGACCCTTTTCAAAGACGTTTATGGCTATGACCTAGATTGGGTATACGACGATA
ACGCGAGTTTTGGTAAAGATGACGCTCAGTTAATTCATGAGCTTTGTGACAACTTCGATGTTGAGCCCGA
GATGATCATGAAACTGATCGAGCTGGAAGTTTCTATGGAAGGCTTAAGCCGCCGTAGCGGTATTTCAAAC
AAAATTGCATCGCTATTGAAGCGAGACTGGGGAAGCTTGGAAGATATTAAACAAAAACATGCTTCCCTAC
AGAGTAAGGCTGAGTTTGATATTCACCAAAAAGAAATTGAGCGTTATAACGAACAACTTGCTGACTTAGA
TAAGCAGCTTCAAAAAGAGTTTTAA
>VFMJ11_A0169|dndD|dndDB1088 Vibrio fischeri MJ11
GTGCATGAAATCGACCTGCGCCCTGCTCCTGCTCGTCTAAGTAAAAATGGTCCAATTGAAGGAACCGAAC
GACCAATCATTCTGTTTGGTGGTCTTAACGGTGCTGGTAAAACATCGATTCTGACAGCAGTACGATTCGC
TCTTTTTGGCCGTCAATCATTTAGCCAAGTACTATCAAATGGCGAGTACGTGGATGCCCTATCCGAGCTT
ATTCATAAAGGTGTCGGCCATGGCGGCGTTCAAGATAACGCATCGATCGAACTTGAGTTTAAATACAGCC
AAAACGGTGAAGAGAACACTTATAAAGTGATTCGCGGTTGGAAGCGCGGTAAGAAAGATAACCTGTACCT
TGAGAAAGATGGTATTCAAATTCCTGAGTTGAATTACGAGCAGTGCCAAGGTTTTCTTAATGAGCTTATT
CCAACGGGTATTGCTGATCTGTTCTTCTTCGACGGCGAGAAAATCGCTGAGCTAGCAGAAGATGAATCTG
GTAGCGTTCTTAAAACAGCTGTGCGTCGTCTACTTGGTTTAGATGTAATCGCGAAACTAAAAAGCGACCT
CAACATTTTCTTAAAGAAACAAGGAGCAGGAGCTTTAAGTCAGTCTTTAAAAGAAGAAATGGATAATCTC
GAGAACATTCGAATTAAACATGAAAGAGAAGCTGACAAGCTCCGATTTGAAGCCGAGAACGAAGTATATA
AGCAGATTATTCATACTAGTTCCGACATCCAAATTTTGGAGAACAAGCTTTCACAGAATGGTGGAGCTTG
GGCAAAAACCAGAGAAGATGAGCAACACAAAGTTGAAAACTTGCTTAAAGAGAAAGTCGAGCTTGAGAAA
CAGATTCGTATGGAAATGGAAACGAACCTTCCATTTTCACTTGCTCCGAAAGCAATGCAAAGGCTTCAAA
CTCAGATCAAACAAGAGCAACAAGTTAAGAAAAAGCAGAACTTTGGTAATGAGCTAGATGCTTTCCTAGA
AACTCTATGCTCAAAATACCCAAGCTTTGATACCGAGATGGCGCAAAACGCAATTGCAGATAGCTTTAAA
GAACACGTAGGTGAATTCGATTCAACAGAGCTTCTTTTGGATATCTCTGATCGCCAAGCGAATACCATCG
ATTACCAATTATCTAACCTATCGCAAGATTCTTTCTCTCGTTTCGACAAAGCACGAGTACGCCTCAGCAA
AGTCGAAGAAGAGATCGACAACGCTTCAAACAATATCGCGCGAGCACCAGAGCAGGAGCAAGTGCAGGAG
TTGTTTGCAGATGTCCGCGCTTTAGATAAGAAAAAAGAAAAGCTGATTATCGAATATCATGACTTGCTGG
AAAAGGCTAAGCAAGAACTTCGACTAGCTTTAGAAACAGCACGCAAAATTCAGAAGCTGCACGATAAAAA
CAAAGATCAATCGAGTAAAGATCAAAGCGTTAGCAATGCTCAAAACTCTATCTTATTACTAGAGAAGTTT
GGAGAGCAGTTAACTAAAGCGCGTGTTAATCAGTTAGAAAATGAATTCGTTCAATCATACAAAAAATTAG
CGCGTAAGGAAGATTTACAACTAACAGCTTCAATCAACCCAGCAACATTCGATGTTGAGTTAGTTGATGA
ACATGGTATTAAAATCAACCGTAAGGCGATGTCTGCTGGTGAGAAGCAGATCTACGCGATCTCGATTCTA
GAGGCTCTTGGCCGTACATCTGGTCGTAAACTTCCAATCATCATTGACACACCACTAGGTCGATTGGATT
CACATCACCGTGACAAACTGGTTGAGAACTATTTCCCAACCGCAAGCCACCAAGTTGTGATTTTATCGAC
TGATACAGAAATCGATAGAAATTATACAAACCTCATCCAAGACGATATTGCTCGCACTTACGAGATCTGT
TTCGACGGTACAACTAAGGCTTCAACGTTGAAAGAAGGTTACTTCTGGAAAGAATCGATTAAGGAGGCCA
TGTAA
>VFMJ11_A0168|dndE|dndDB1089 Vibrio fischeri MJ11
ATGCTACCTAACCGCATGAACTTGACTCGCTCTACAGAAGAGCAACTTAAGAAGTTGAAGGGCTATACTG
GAATCACTCCAAACGTATCGGCTCGTATCGCTTTCTTCCGCTCAATTGAAAGTGACTTTCGATACCAAGG
CCAAGAAGCTAAGTTGGACGGCTCACTTGTACTAGATAAGTACACGTGGCTTGGTGAAACTAGTGATGTG
ACTGAACTAATGTTGAAGATGTACTACCCAGAGTTTGATACCAAAGAGTATCAACAAGCTTGGGCAGCAC
ATGTTGAAGATGGGATTGCTGCACTAAGAAACCATAAGAATCTGTTAGGCTTATCAATCAACCTATAA