Summary Sequence Context  
1 homologue found:
Download sequences in FASTA format.

>VFMJ11_A0168|dndE|dndDB1089 Vibrio fischeri MJ11
ATGCTACCTAACCGCATGAACTTGACTCGCTCTACAGAAGAGCAACTTAAGAAGTTGAAGGGCTATACTG
GAATCACTCCAAACGTATCGGCTCGTATCGCTTTCTTCCGCTCAATTGAAAGTGACTTTCGATACCAAGG
CCAAGAAGCTAAGTTGGACGGCTCACTTGTACTAGATAAGTACACGTGGCTTGGTGAAACTAGTGATGTG
ACTGAACTAATGTTGAAGATGTACTACCCAGAGTTTGATACCAAAGAGTATCAACAAGCTTGGGCAGCAC
ATGTTGAAGATGGGATTGCTGCACTAAGAAACCATAAGAATCTGTTAGGCTTATCAATCAACCTATAA