Summary Sequence Alignment 16S rRNA Context  
4 homologues found:
Download sequences in FASTA format.

>CKO_03498|dndB|dndDB1094 Citrobacter koseri ATCC BAA-895
ATGCATGATCGTAACCAGACAAATTACTTTTACATGTTTCCTGCGGTACGTGGAATGCAGGCAGGAAGAG
AGTTTTACATTGCGACCTGCCCATTGCTGACAATTCCAAAGATTTTCAGCTTTGATGAAGAAGAGGTTCC
ACCTGAACTGCGGGCGCAGCGCTCATTAAATAAAGCACGGATACCCGACATGGTGCGTTATCTGTTGGAT
AATCCAGATAACTATATTTTTTCTGCACTTACCGCTTCTGTTGCTGTTGATGTGCATTTTGAAGCAATTA
ACGATGCTGGGAGTCTGGGTACGTTACAAGTGCCTATGGGAGCCCAAATTTTGATTAATGACGGGCAGCA
TAGACGAAAGGCTATCGAAGAAGCATTAAAAGCAAACCCTGAGCTGGGATATGACAACATTCCGGTTTTG
TTCTTCGTTGATCGGGGGTTAGTGAGAAGCCAACAGATGTTTGCTGATTTGAACAAATACGCGGTTAGAC
CAAGCCCTTCGTTGGCGACCCTCTATGATCACCGAGATCCAAGCGCTCAACTTGCCTGCCATCTGGCTGA
AAATATTGAGCCGTTTATTGGTTTCACAGAAATGGAAAAATCAAGCATATCATCGCTTTCCAATAAGCTT
TTTACGTTGAGCAGCATCAAGCAGGCGACGAAAGCATTACTCGGTAAAGGGCTGAAAGATTTGTACTCCG
ATGACGAAAAGCATAAAGCGGAACGTTTCTGGCGTGCTGTGTTTGGAGTTATGCCCGAATGGCAAATGGT
ACGACGCCGTGAGATTTCTCCAGCGAGTATGCGTCAGGAATTTATCCATTCTCACGGTGTAGGTTTACAG
GCCATCGGTTTGATGGGTAAGGGATTGCTACAACATTCGCCATATAACTGGGAGCAAAAGTTGGAAGGTT
TGAGAGATATTGACTGGCGAAAGGCGAATCCGGAATGGCTAAAACGCACGATGCTGCATGGAAAAATCAG
CAAATCAGCGATATCGATACACTTAACCAGTAATGCTCTGAAACAGAAACTCGGCATTCCTTTAAATTCA
GAAGAACAAAAATTAGAAGAGCAACTGAAGTCATGA
>CKO_03497|dndC|dndDB1095 Citrobacter koseri ATCC BAA-895
ATGAGTCATTTATTACAAGCATATGATCTTGATAGTTACGAAGATTTTATTAATCAGGAAACCTTTGCTG
GGCGTCCATTACATGAATTTGTATCTGAGATCCAGCGGATCTATCTGGCTGATAAACGTCCTTGGGTTAT
TGGCTACAGTGGCGGTAAGGATTCGTCTGCTGTAACAACTCTTATTTATCTGGCATTACTGGGATTGTCT
CCCGAGCAGCGTAATAAGCCTGTTTTTGTCGTATGTTCAGATACTTTGGTCGAGACACCAGTAGTTGTAA
ACCTGATCAGTCGAACATTGAAGCTAATAGAAAGAGGTGCTCGCCAGGATGGTTTGCCCATATTGGTGCA
ACAAGTTGTTCCTAAAACGCATGAAACATTTTGGGCAAACCTTTTAGGAAAGGGATATCCGGCACCTACT
CGGCAGTTCCGCTGGTGTACCGAACGTATGAAAATCAATCCGGTTAGTGACTTTATTCGAGATAAAGTAA
GTCAGTTCGAAGAAGTTATTGTGGTTTTAGGGTCCCGTTCTGCAGAAAGTGCATCCCGTGCTCAGGTAAT
TGCAAAACACAAGATTGATGGGACTCGATTAGCTCGTCATACCACCTTAGCTAATGCGTTTATCTATACC
CCTATTGATACTTGGGGGGTTGATGATGTCTGGAAATTGTTGAGAGGTGCATTCCGCTATTCAAGTGATG
TAACCGAATGGGAAACACCTTGGGGAGGTGGGAACAACCTTCCTTTATGGACTTTGTATATGGACTCCTC
TGGTCAGGGGGAATGCCCTATGGTTATTGATGACAGCACCCCGTCTTGTGGTAATTCGCGATTTGGGTGC
TGGACTTGTACTGTTGTAACCAAAGATCGGGCTATGGAAAGTCTAGTTCAAAACGGAGAGCAATGGATGG
CTCCGTTGTTGGAGTTTCGCAATATGCTTGCGAAGACTACTGAACCAGAAGAGAAAGATAAGTACCGTAA
CTTTAAGCGCCGAACTGGAAAGGTTAGTTATCAGTATTTAAAAGAGGGGGAGGATATTTCGGTTGAACGA
AAACATGTTCCTGGCCCCTATTTATTGAAATATCGACAAGAATGGCTGGAGAAGTTGCTCAACCTGGATA
AGGTCTTGAAAGCACAAGGACATGATATTCAGCTTATAACTGAAGGGGAGTTACATGCTATTCGTCAGGA
GTGGCTTAATGATCCTAATGAACCTGATTGGAATGATTCTCTGCCAAAAATCTATAAACGTGTATATGGT
CATGATTTAGCTTGGCAGATAGATGAACGAGTTCGTTTTGCTGGTGCAGATGCAGGACTACTTCATGAAC
TAGCCACTGAACATGGAATTGTCCCTGAGATGGTCATGAAGCTGATTGATCTTGAGATCTCTTTTGAAGG
AATGGGGCGCCGTCAAAATGTTCAAAAGAAAGTAGAATCGATATTACAACAGGATTGGGGAACATTTGAA
GAGATCAAGGAAAAATACTCTTCGGTTCAGAAAAAGAATCAATTCGATATGCTTTTAAAAGAAAAAGAAG
ATATTGAACTTGCTTTGGATGATCTATCAAATGATTTTGATAGGCTTGAGAACATATTAAATAGTGTGAC
CAGTAATGATGAGGTGGCAAAATGA
>CKO_03496|dndD|dndDB1096 Citrobacter koseri ATCC BAA-895
ATGATTATAACTAAACTGGTTATGCGTAATTTCCGCGTGTTTCGTGGTGAACATGTGCTCGATCTTGCTC
CAAATGATGAACCTGGAAAGCCACTAATTTTGATTGGTGGTCTTAATGGTTCTGGGAAAACTTCTATTTT
AACTGCAATACGACTTGCCTTGTATGGATCACAAGCATTTGATGATGTTTTTACCAAGAATTCCTATATT
GAGAGATTATCGTCTTTAGTCCATAACGGAAAACCTGATGATTTTGAAGATTTTACCTCTGCTTTTGTGG
AACTTAGTTTCACACTTCGAATTGATGGAGAAGATGTCACGTACTGTACAAAACGATCATGGTCAAAAGG
TAGGGGCGATCAACTCTCTATTTCTGAGAATGGGGTGCTTATGGAGGGAAAAAGCCCGGAGCAGTTACAG
GGTTTCCTAAATGAGCTGATCCCTGTTGGTGTTGGTGAATTATTCTTCTTTGATGGGGAAAAAATTGCCA
CGCTTGCAGAAGATGAGACTGGAAGCATTTTAAGGATAGCTATGCAACGTCTACTAGGACTTGACGTTGT
ATCTCGGTTAAAAGGAGATCTAAATACCTACATCAAAAATGATCAGAAAAACAAGCTTAATCGTGTTGCA
CAGGAACAAGTTAAAGTACTTGAAAAAAAGAAGAATGACCTTATTTCATATGCTAATGAAAAAAGAAGCG
AAGCACTCGATTATTTGAAAGGTATTGAATTAAATATCAAAGATTTACGTAAGTATGAAGCTTTATTGAT
GGCGCAAGGAAAAAATTTTGCAGACTCAAAAGTGAGTGAGGAAGCGAAATTAAGAAGTTTAGAGACTGAA
AAACTATATACAGAAAAGCAATTGCGTAATACCCTTGACGGATATTTCCCTTTTTCATTAGCGCCAAATA
TATTTAGAGATCTTTTTAACCAAGTAGAACTGGAAAAAGAAATAATAAAAGCTACCGCATTCAAGTCAGG
TCTTGATGATTTTCTGAAAAAACTCCGGAATGAATTGGCGATCCGGTCATCTACAACGTTGAAAATTGCT
ACAGAGACAATTGAAGATCAATTAAAAGATTTTCTATTGACTCAACCGTCCGGGGATATCCTGCTAGATG
TCTCTGAACGTGAGTCTGGTATTTTACATAATGCAGTCTACACATTATCGCCTAAATTAAAAAAAGAAAA
AAATAGACTTTGCGAAGAGATAAAAAGAATTGACTTGGCTATTGAACATGCAAAAGAAAATATCGAAAGA
TCTCCTGAGGAAGAACAGTTAAGTAGTACTTTCAATATTATTAGGACTTTTGACAAGAACATACGTGATG
CCGTAGATGAGTTTAAAAAACTACACCTTGATGCTAAAACAGCACTAACTGAAGCGTTAGAGTGTACTCG
AGAACAGCAGAAGCTTCATGACGCAATAAAGAATAAAGTTGCACTGGAAAATGCTAGTGATTATGCCCTA
TCTATATTACCTCTTCTTGATGAATACGCCAAAAAACTGACACAGAAGCGTATATCTGAAGTGGAACAAG
AGTTTTCTCGAGTATATAAGAAGTTGGCAAGGAAGGACGAGTTAAAATTACGAGCTAAAATTGATGTAAA
TACATTTAATGTGAATCTTCAAGATGAAGATGGATTAATAATTGATCGTAGTTTATTGTCTGCTGGTGAA
AAACAGATATATGCAGTCACTATGCTTGAAGCATTAGGGAATGTTTCTGGGAAATTACTTCCTATTATAA
TTGATACTCCTTTAGGAAGGTTAGACTCGCATCATAGAGATAAGTTAGTTGAACACTATATCCCAGATGC
TAGTCACCAGGTCATTATCCTATCTACCGATACGGAAATTGATGAGAGATATTACAAAAATTATCTCTGT
GATTGTATTTCAAAATCTTATGAAATAAGATACTCACCATTTAGTCAATCTTCAAAGATTGAAGACGGCT
ATTTTTGGAAAAATGCAAAATGTGAGGTGAATGCCTAA
>CKO_03495|dndE|dndDB1097 Citrobacter koseri ATCC BAA-895
ATGTTACCTAATCGTTTGCAACTGAACATTCGTGTTGAAGATCAACTTAAAAGACTAAAAGCTAGCACGG
GGGTTAATCCAAATATTTCTGCTCGGATAGCATTTTTCCGTTCTGTAGAAAGTGGCTATCGTTTTGACGG
AAATGACTATAAAACTGATGGCAATATGAGTATGGATAAAGCTGTATGGTTGGGAGATACAGGTGTAGCT
ACTGAACTTATATTGAAGATGTTGTATCCCAATTTTGATGGAAAAAAAATGATGCAAGCTTGGGCTGCAC
ATGTTGACGATGGGTCTGCATCCTTGCGAAACCATCGTGAATTAATTAGTTTTACTACATCTCTTTAA