Gene information

OrganismStreptomyces lividans 1326
HomologuedndC
GID1028
PID2028
locus tagSLG78
length1497 bp
G+C%0.65
link  gi:145244267  
SequenceATGAGCACCCCCAAGGCGGCGGCGCCTTTCCAGGACCGGCCCCTGGCAGAGATCGTCGAGGAGCTGACGG
AGGAGATCCGCGAGCTCTACGTCGCTGATGAGGTGCCGTGGGTGGTCGGGTACAGCGGCGGCAAGGACTC
CACCGCCGTCCTCCAACTGGTCTGGCTCGCGCTCAAGGACCTACCGGCCGAACAGCGCACGAAGCCGGTG
CATGTGATCAGCACGGACACCCTGGTGGAGAACCCCGTCGTCGCTGCATGGGTAGGCCAGTCCCTGGACA
CCATGCGCACCGCCGCGCAGGAACAGCAGCTGCCCATCGAGTCGCACAAACTGACCCCGGAGATCAAAGA
CACCTTCTGGGTCAGCCTGATCGGCAAGGGCTACCCTGCACCCCGCCCGAAGTTCCGGTGGTGCACCGAG
CGGTTGAAGATCAAGCCATCGAACGCCTTCATCCGGCGCGTCGTACGCCGGCACGGCGAGGCGATCCTCG
TACTGGGAATCCGCAAGGCCGAAAGCCAAGCACGGGCACGGGCGATGGCCCGGCACGAGAAGGGGCGGGT
CCGTGACCGGCTCTCACCCAACGGCAACCTCCCCAACTCCCTTGTCTACAGCCCCATCGAGGCGTGGTCG
ACCGAGGAGGTCTGGGCGTTCTTGATGCAATACCCCAATCCGTGGGGCCACAAGAACAAGGATCTGCTGA
CCATGTACCAGGGTGCGTCGGACGACTCTGAGTGCCCGCTGGTCGTCGACGACACCACCCCCTCGTGCGG
TGACAGCCGCTTCGGATGCTGGACCTGCACGCTGGTGGAGCAGGACAAGTCGATGACCGCCATGATCCGC
AACGACGACGAGAAGCAGTGGATGCGGCCGTTGCTCAAGCTCCGCAACGAGCTCGACGACGTCACCAAGG
AAGCTCAAACACGGGACTTCCGCCGCATGAACGGCAACGTGCAGCTGTTCGGCGACCGGCCCATCCCCGG
CCCATACAAGCAGTCCGCCCGCGAAGACTGGCTGCGCAAGCTCCTCGCCGCCCAAGCCCAGGTCCGCAAG
AAGGCACCCGAGCACGTGCGTAACATTGAGCTGATCTCGATGGCGGAGCTGCAGGAGATCCGGCGGATCT
GGGTCTTCGAGAAGCACGAAGTCGAGGACTCCCTGCCGCAGATCTACGAGCAGGCGACCGGCGAGAAGTT
CCCCGGACTGCCGCTCGACGAGCAGCTCGTCCTGGGCGCCGAGGAGATCGGCCTGCTCAAGGAGGCCTGC
GAGGACGATCCGATCCACTTCTCGATGACCCGTGAGCTCCTCGCGATCGAGCGCCAGTATCGAACCATGA
CCCGGCGGGCCGGCCTCTTCGAGGCCCTGGAGAAGGCGATCAAGAAGGGCTACTACGAGGACGCGGACGA
CGCGCTGCGGTTCGCCAAGCGGCTGCAGGAAATGCGCGAGAGCGACCCGACACAGACGACGGCGGACGAA
GAGATCACCACCGATGCACCTGCATAA