Gene information

OrganismVibrio fischeri MJ11
HomologuedndB
GID1086
PID2086
locus tagVFMJ11_A0171
length1080 bp
G+C%0.383
link  gi:197336667  
SequenceATGAACAATCACGAATCTGGTTATTGCTATTCATTTCCTGCGGTTAAAGGCATACAAGCAGGTAGACCAT
TCTACATAGCGACCTGCCCTCTACGTATTATTCCAAAGATTTTCAGTTATAACGAAGATGATGTACCACC
CGAGCTACGTGCTCAACGTACTCTAAATAAAACTAGAATCCCTGAAATGGTACGTTACCTTCTTGAAAAT
CCTACAGAATATGTATTCTCTGCTTTAACCGCTTCTGTAGGTGTAGATATCTCATTTAACGAGCATGAAG
GCGCACCTAATCTAGGTATTCTTCATATTCCTATGGATGCACAGATCTTAATCAATGACGGTCAACACAG
ACGTAAAGCGATAGAAGAAGCATTAAGAGAAAACCCAGATCTTGGACAAGATAACATTGCAGTACTCTTC
TTTATTGATGAAGGCTTAGATCGTAGTCAACAAATGTTCGCCGATCTAAATAAATATGCCGTAAAACCAA
GTCCATCACTGGGCACCTTGTATGACCATCGTGATGAAAGCTCAGAACTTGCTCGATTATTAGCGAGTTC
AGTTCAACCATTTATTGGTTTAACTGAAATGGAAAAATCAAATATTTCGCCAAAATCGAATAAGTTATTC
ACGTTAAGTAGTATCAAACAATCCACTCGCGCTCTTTTAAGTAAAGGGGCAAAAGACGGTTTTAACGATG
AAGAAAAAGCATTAGCTTCTGAGTATTGGCAAGAAGTAACAAAACACATCAAAGATTGGCAACTTGTTCT
AAAAAAAGAAGTATCTCCAGCTCAACTACGTCAAGAGTTCATTCATGCTCACGGCCTTGGGCTCCACGCT
TTAGGCTTACTAGGTAAACATTTACTTTGCCAAGAGCCAAATAATTGGAAAGAAAAGCTTTCTTTATTAT
CTGAAGTAGATTGGAGAAAAACGAATAAAGACTGGTTGCAGCGTAGTATGAACCACGGCAAGTTGAGTAA
ATCAACAACCAACATTCAGCTAACTACAAACGCATTAAAAATGAAGCTAGGGTTAACGCTAACTCCTGAA
GAACAAACGCTAGAGAAGCAATTATCATGA