Gene information

OrganismVibrio fischeri MJ11
HomologuedndC
GID1087
PID2087
locus tagVFMJ11_A0170
length1635 bp
G+C%0.414
link  gi:197336667  
SequenceATGATACATGACCTCCAACTAACGGAAGACCTTGCAGAAGAATATCAAGAGTTTATTAACACTGAAGACT
TCGCAAATCACAAATTAAGCCACTATGTAGCAGATGTTCAACGTGTTTATTGTGCAGATAATAGACCTTG
GGTGATCGGTTACAGTGGAGGTAAAGACTCCTCTGCTATCATGTCACTTGTTTATCTTGCTCTTCTTGGA
CTAAAAGAAGAAGACCGAACAAAACAAGTGTTTGTTGTTACTTCAGATACCCTAGTCGAAACGCCTGTTG
TGGTAAATCATATCAACGATTCACTCGCCGCTATTCAAACTGGTGCAAAACGTGATGGGTTACCTATTAC
TTGTCACAAGGTAGTACCTGAAGATGATCAAACATTTTGGTCAAGCTTACTCGGTAAAGGCTATCCTGCA
CCTACTCGTTCTTTCCGTTGGTGTACTGAAAGAATGAAAATTAATCCTGTTAGTGACTTCATTAAATCTA
AAGTTTCTCAATTTGATGAGGTTATTGTTGTACTTGGCTCTCGCAGTCAAGAGAGTGCTTCTCGTGCACA
AGTTATTGCTAAGCACAAAATTGACGGCTCACGTTTAGCTCGTCATACAACGCTAGCGAATGCCTTCATT
TTTACACCAATTGATACTTGGGGTGTCGATGACGTTTGGAAAATCTTACGTTTATGCCACTTAGTCACCA
AAGAAACACCTTATGGCACCAAAAACATTTGGAGCAATGACTACGATTTAGAATGGGAAAACCCATGGGG
TGGTAAAAACTTAACACTCTGGAATCTATATAAAGATTCATCAGGTCAGGGCGAATGTCCAATGGTAATT
GATGAAACAACACCTTCTTGTGGTAATTCTCGTTTTGGTTGTTGGACTTGTACCGTTGTTACGCGTGACC
GTGCAATGGAGAGTCTTATTCAAAATGGTGAAGAATGGATGGCTCCTCTTCTGGAGTTCCGAAATAAGTT
AGCAATGACAACGGATCCAGCGAACAAGGAAGAATACCGAAACCACAAACGTCGAACCGGTAAAGTAAGC
TACCAATACGCCAAAGAAGGTGAAGATATAGCTAGCGAGCGAAAGCACGTACCGGGCCCTTACTGGCTTA
AATACCGTCGCCAATGGCTTCGTGAACTTCTAGAACTAGATAAGAAGTTTAAAGCTGAAGGCCGAGAGAT
TGAGCTAATCACGGTGCCAGAGCTACATGCTATTCGTCAAGAATGGATCAAAGATCCAAATGAACCAGAC
TGGGATGACTCTCTACCGACCCTTTTCAAAGACGTTTATGGCTATGACCTAGATTGGGTATACGACGATA
ACGCGAGTTTTGGTAAAGATGACGCTCAGTTAATTCATGAGCTTTGTGACAACTTCGATGTTGAGCCCGA
GATGATCATGAAACTGATCGAGCTGGAAGTTTCTATGGAAGGCTTAAGCCGCCGTAGCGGTATTTCAAAC
AAAATTGCATCGCTATTGAAGCGAGACTGGGGAAGCTTGGAAGATATTAAACAAAAACATGCTTCCCTAC
AGAGTAAGGCTGAGTTTGATATTCACCAAAAAGAAATTGAGCGTTATAACGAACAACTTGCTGACTTAGA
TAAGCAGCTTCAAAAAGAGTTTTAA