Gene information

OrganismVibrio fischeri MJ11
HomologuedndD
GID1088
PID2088
locus tagVFMJ11_A0169
length1965 bp
G+C%0.414
link  gi:197336667  
SequenceGTGCATGAAATCGACCTGCGCCCTGCTCCTGCTCGTCTAAGTAAAAATGGTCCAATTGAAGGAACCGAAC
GACCAATCATTCTGTTTGGTGGTCTTAACGGTGCTGGTAAAACATCGATTCTGACAGCAGTACGATTCGC
TCTTTTTGGCCGTCAATCATTTAGCCAAGTACTATCAAATGGCGAGTACGTGGATGCCCTATCCGAGCTT
ATTCATAAAGGTGTCGGCCATGGCGGCGTTCAAGATAACGCATCGATCGAACTTGAGTTTAAATACAGCC
AAAACGGTGAAGAGAACACTTATAAAGTGATTCGCGGTTGGAAGCGCGGTAAGAAAGATAACCTGTACCT
TGAGAAAGATGGTATTCAAATTCCTGAGTTGAATTACGAGCAGTGCCAAGGTTTTCTTAATGAGCTTATT
CCAACGGGTATTGCTGATCTGTTCTTCTTCGACGGCGAGAAAATCGCTGAGCTAGCAGAAGATGAATCTG
GTAGCGTTCTTAAAACAGCTGTGCGTCGTCTACTTGGTTTAGATGTAATCGCGAAACTAAAAAGCGACCT
CAACATTTTCTTAAAGAAACAAGGAGCAGGAGCTTTAAGTCAGTCTTTAAAAGAAGAAATGGATAATCTC
GAGAACATTCGAATTAAACATGAAAGAGAAGCTGACAAGCTCCGATTTGAAGCCGAGAACGAAGTATATA
AGCAGATTATTCATACTAGTTCCGACATCCAAATTTTGGAGAACAAGCTTTCACAGAATGGTGGAGCTTG
GGCAAAAACCAGAGAAGATGAGCAACACAAAGTTGAAAACTTGCTTAAAGAGAAAGTCGAGCTTGAGAAA
CAGATTCGTATGGAAATGGAAACGAACCTTCCATTTTCACTTGCTCCGAAAGCAATGCAAAGGCTTCAAA
CTCAGATCAAACAAGAGCAACAAGTTAAGAAAAAGCAGAACTTTGGTAATGAGCTAGATGCTTTCCTAGA
AACTCTATGCTCAAAATACCCAAGCTTTGATACCGAGATGGCGCAAAACGCAATTGCAGATAGCTTTAAA
GAACACGTAGGTGAATTCGATTCAACAGAGCTTCTTTTGGATATCTCTGATCGCCAAGCGAATACCATCG
ATTACCAATTATCTAACCTATCGCAAGATTCTTTCTCTCGTTTCGACAAAGCACGAGTACGCCTCAGCAA
AGTCGAAGAAGAGATCGACAACGCTTCAAACAATATCGCGCGAGCACCAGAGCAGGAGCAAGTGCAGGAG
TTGTTTGCAGATGTCCGCGCTTTAGATAAGAAAAAAGAAAAGCTGATTATCGAATATCATGACTTGCTGG
AAAAGGCTAAGCAAGAACTTCGACTAGCTTTAGAAACAGCACGCAAAATTCAGAAGCTGCACGATAAAAA
CAAAGATCAATCGAGTAAAGATCAAAGCGTTAGCAATGCTCAAAACTCTATCTTATTACTAGAGAAGTTT
GGAGAGCAGTTAACTAAAGCGCGTGTTAATCAGTTAGAAAATGAATTCGTTCAATCATACAAAAAATTAG
CGCGTAAGGAAGATTTACAACTAACAGCTTCAATCAACCCAGCAACATTCGATGTTGAGTTAGTTGATGA
ACATGGTATTAAAATCAACCGTAAGGCGATGTCTGCTGGTGAGAAGCAGATCTACGCGATCTCGATTCTA
GAGGCTCTTGGCCGTACATCTGGTCGTAAACTTCCAATCATCATTGACACACCACTAGGTCGATTGGATT
CACATCACCGTGACAAACTGGTTGAGAACTATTTCCCAACCGCAAGCCACCAAGTTGTGATTTTATCGAC
TGATACAGAAATCGATAGAAATTATACAAACCTCATCCAAGACGATATTGCTCGCACTTACGAGATCTGT
TTCGACGGTACAACTAAGGCTTCAACGTTGAAAGAAGGTTACTTCTGGAAAGAATCGATTAAGGAGGCCA
TGTAA