Gene information

OrganismVibrio fischeri MJ11
HomologuedndE
GID1089
PID2089
locus tagVFMJ11_A0168
length348 bp
G+C%0.425
link  gi:197336667  
SequenceATGCTACCTAACCGCATGAACTTGACTCGCTCTACAGAAGAGCAACTTAAGAAGTTGAAGGGCTATACTG
GAATCACTCCAAACGTATCGGCTCGTATCGCTTTCTTCCGCTCAATTGAAAGTGACTTTCGATACCAAGG
CCAAGAAGCTAAGTTGGACGGCTCACTTGTACTAGATAAGTACACGTGGCTTGGTGAAACTAGTGATGTG
ACTGAACTAATGTTGAAGATGTACTACCCAGAGTTTGATACCAAAGAGTATCAACAAGCTTGGGCAGCAC
ATGTTGAAGATGGGATTGCTGCACTAAGAAACCATAAGAATCTGTTAGGCTTATCAATCAACCTATAA