Gene information

OrganismCitrobacter koseri ATCC BAA-895
HomologuedndB
GID1094
PID2094
locus tagCKO_03498
length1086 bp
G+C%0.443
link  gi:157144296  
SequenceATGCATGATCGTAACCAGACAAATTACTTTTACATGTTTCCTGCGGTACGTGGAATGCAGGCAGGAAGAG
AGTTTTACATTGCGACCTGCCCATTGCTGACAATTCCAAAGATTTTCAGCTTTGATGAAGAAGAGGTTCC
ACCTGAACTGCGGGCGCAGCGCTCATTAAATAAAGCACGGATACCCGACATGGTGCGTTATCTGTTGGAT
AATCCAGATAACTATATTTTTTCTGCACTTACCGCTTCTGTTGCTGTTGATGTGCATTTTGAAGCAATTA
ACGATGCTGGGAGTCTGGGTACGTTACAAGTGCCTATGGGAGCCCAAATTTTGATTAATGACGGGCAGCA
TAGACGAAAGGCTATCGAAGAAGCATTAAAAGCAAACCCTGAGCTGGGATATGACAACATTCCGGTTTTG
TTCTTCGTTGATCGGGGGTTAGTGAGAAGCCAACAGATGTTTGCTGATTTGAACAAATACGCGGTTAGAC
CAAGCCCTTCGTTGGCGACCCTCTATGATCACCGAGATCCAAGCGCTCAACTTGCCTGCCATCTGGCTGA
AAATATTGAGCCGTTTATTGGTTTCACAGAAATGGAAAAATCAAGCATATCATCGCTTTCCAATAAGCTT
TTTACGTTGAGCAGCATCAAGCAGGCGACGAAAGCATTACTCGGTAAAGGGCTGAAAGATTTGTACTCCG
ATGACGAAAAGCATAAAGCGGAACGTTTCTGGCGTGCTGTGTTTGGAGTTATGCCCGAATGGCAAATGGT
ACGACGCCGTGAGATTTCTCCAGCGAGTATGCGTCAGGAATTTATCCATTCTCACGGTGTAGGTTTACAG
GCCATCGGTTTGATGGGTAAGGGATTGCTACAACATTCGCCATATAACTGGGAGCAAAAGTTGGAAGGTT
TGAGAGATATTGACTGGCGAAAGGCGAATCCGGAATGGCTAAAACGCACGATGCTGCATGGAAAAATCAG
CAAATCAGCGATATCGATACACTTAACCAGTAATGCTCTGAAACAGAAACTCGGCATTCCTTTAAATTCA
GAAGAACAAAAATTAGAAGAGCAACTGAAGTCATGA