Gene information

OrganismCitrobacter koseri ATCC BAA-895
HomologuedndC
GID1095
PID2095
locus tagCKO_03497
length1635 bp
G+C%0.417
link  gi:157144296  
SequenceATGAGTCATTTATTACAAGCATATGATCTTGATAGTTACGAAGATTTTATTAATCAGGAAACCTTTGCTG
GGCGTCCATTACATGAATTTGTATCTGAGATCCAGCGGATCTATCTGGCTGATAAACGTCCTTGGGTTAT
TGGCTACAGTGGCGGTAAGGATTCGTCTGCTGTAACAACTCTTATTTATCTGGCATTACTGGGATTGTCT
CCCGAGCAGCGTAATAAGCCTGTTTTTGTCGTATGTTCAGATACTTTGGTCGAGACACCAGTAGTTGTAA
ACCTGATCAGTCGAACATTGAAGCTAATAGAAAGAGGTGCTCGCCAGGATGGTTTGCCCATATTGGTGCA
ACAAGTTGTTCCTAAAACGCATGAAACATTTTGGGCAAACCTTTTAGGAAAGGGATATCCGGCACCTACT
CGGCAGTTCCGCTGGTGTACCGAACGTATGAAAATCAATCCGGTTAGTGACTTTATTCGAGATAAAGTAA
GTCAGTTCGAAGAAGTTATTGTGGTTTTAGGGTCCCGTTCTGCAGAAAGTGCATCCCGTGCTCAGGTAAT
TGCAAAACACAAGATTGATGGGACTCGATTAGCTCGTCATACCACCTTAGCTAATGCGTTTATCTATACC
CCTATTGATACTTGGGGGGTTGATGATGTCTGGAAATTGTTGAGAGGTGCATTCCGCTATTCAAGTGATG
TAACCGAATGGGAAACACCTTGGGGAGGTGGGAACAACCTTCCTTTATGGACTTTGTATATGGACTCCTC
TGGTCAGGGGGAATGCCCTATGGTTATTGATGACAGCACCCCGTCTTGTGGTAATTCGCGATTTGGGTGC
TGGACTTGTACTGTTGTAACCAAAGATCGGGCTATGGAAAGTCTAGTTCAAAACGGAGAGCAATGGATGG
CTCCGTTGTTGGAGTTTCGCAATATGCTTGCGAAGACTACTGAACCAGAAGAGAAAGATAAGTACCGTAA
CTTTAAGCGCCGAACTGGAAAGGTTAGTTATCAGTATTTAAAAGAGGGGGAGGATATTTCGGTTGAACGA
AAACATGTTCCTGGCCCCTATTTATTGAAATATCGACAAGAATGGCTGGAGAAGTTGCTCAACCTGGATA
AGGTCTTGAAAGCACAAGGACATGATATTCAGCTTATAACTGAAGGGGAGTTACATGCTATTCGTCAGGA
GTGGCTTAATGATCCTAATGAACCTGATTGGAATGATTCTCTGCCAAAAATCTATAAACGTGTATATGGT
CATGATTTAGCTTGGCAGATAGATGAACGAGTTCGTTTTGCTGGTGCAGATGCAGGACTACTTCATGAAC
TAGCCACTGAACATGGAATTGTCCCTGAGATGGTCATGAAGCTGATTGATCTTGAGATCTCTTTTGAAGG
AATGGGGCGCCGTCAAAATGTTCAAAAGAAAGTAGAATCGATATTACAACAGGATTGGGGAACATTTGAA
GAGATCAAGGAAAAATACTCTTCGGTTCAGAAAAAGAATCAATTCGATATGCTTTTAAAAGAAAAAGAAG
ATATTGAACTTGCTTTGGATGATCTATCAAATGATTTTGATAGGCTTGAGAACATATTAAATAGTGTGAC
CAGTAATGATGAGGTGGCAAAATGA