Gene information

OrganismCitrobacter koseri ATCC BAA-895
HomologuedndD
GID1096
PID2097
locus tagCKO_03496
length1998 bp
G+C%0.356
link  gi:157144296  
SequenceATGATTATAACTAAACTGGTTATGCGTAATTTCCGCGTGTTTCGTGGTGAACATGTGCTCGATCTTGCTC
CAAATGATGAACCTGGAAAGCCACTAATTTTGATTGGTGGTCTTAATGGTTCTGGGAAAACTTCTATTTT
AACTGCAATACGACTTGCCTTGTATGGATCACAAGCATTTGATGATGTTTTTACCAAGAATTCCTATATT
GAGAGATTATCGTCTTTAGTCCATAACGGAAAACCTGATGATTTTGAAGATTTTACCTCTGCTTTTGTGG
AACTTAGTTTCACACTTCGAATTGATGGAGAAGATGTCACGTACTGTACAAAACGATCATGGTCAAAAGG
TAGGGGCGATCAACTCTCTATTTCTGAGAATGGGGTGCTTATGGAGGGAAAAAGCCCGGAGCAGTTACAG
GGTTTCCTAAATGAGCTGATCCCTGTTGGTGTTGGTGAATTATTCTTCTTTGATGGGGAAAAAATTGCCA
CGCTTGCAGAAGATGAGACTGGAAGCATTTTAAGGATAGCTATGCAACGTCTACTAGGACTTGACGTTGT
ATCTCGGTTAAAAGGAGATCTAAATACCTACATCAAAAATGATCAGAAAAACAAGCTTAATCGTGTTGCA
CAGGAACAAGTTAAAGTACTTGAAAAAAAGAAGAATGACCTTATTTCATATGCTAATGAAAAAAGAAGCG
AAGCACTCGATTATTTGAAAGGTATTGAATTAAATATCAAAGATTTACGTAAGTATGAAGCTTTATTGAT
GGCGCAAGGAAAAAATTTTGCAGACTCAAAAGTGAGTGAGGAAGCGAAATTAAGAAGTTTAGAGACTGAA
AAACTATATACAGAAAAGCAATTGCGTAATACCCTTGACGGATATTTCCCTTTTTCATTAGCGCCAAATA
TATTTAGAGATCTTTTTAACCAAGTAGAACTGGAAAAAGAAATAATAAAAGCTACCGCATTCAAGTCAGG
TCTTGATGATTTTCTGAAAAAACTCCGGAATGAATTGGCGATCCGGTCATCTACAACGTTGAAAATTGCT
ACAGAGACAATTGAAGATCAATTAAAAGATTTTCTATTGACTCAACCGTCCGGGGATATCCTGCTAGATG
TCTCTGAACGTGAGTCTGGTATTTTACATAATGCAGTCTACACATTATCGCCTAAATTAAAAAAAGAAAA
AAATAGACTTTGCGAAGAGATAAAAAGAATTGACTTGGCTATTGAACATGCAAAAGAAAATATCGAAAGA
TCTCCTGAGGAAGAACAGTTAAGTAGTACTTTCAATATTATTAGGACTTTTGACAAGAACATACGTGATG
CCGTAGATGAGTTTAAAAAACTACACCTTGATGCTAAAACAGCACTAACTGAAGCGTTAGAGTGTACTCG
AGAACAGCAGAAGCTTCATGACGCAATAAAGAATAAAGTTGCACTGGAAAATGCTAGTGATTATGCCCTA
TCTATATTACCTCTTCTTGATGAATACGCCAAAAAACTGACACAGAAGCGTATATCTGAAGTGGAACAAG
AGTTTTCTCGAGTATATAAGAAGTTGGCAAGGAAGGACGAGTTAAAATTACGAGCTAAAATTGATGTAAA
TACATTTAATGTGAATCTTCAAGATGAAGATGGATTAATAATTGATCGTAGTTTATTGTCTGCTGGTGAA
AAACAGATATATGCAGTCACTATGCTTGAAGCATTAGGGAATGTTTCTGGGAAATTACTTCCTATTATAA
TTGATACTCCTTTAGGAAGGTTAGACTCGCATCATAGAGATAAGTTAGTTGAACACTATATCCCAGATGC
TAGTCACCAGGTCATTATCCTATCTACCGATACGGAAATTGATGAGAGATATTACAAAAATTATCTCTGT
GATTGTATTTCAAAATCTTATGAAATAAGATACTCACCATTTAGTCAATCTTCAAAGATTGAAGACGGCT
ATTTTTGGAAAAATGCAAAATGTGAGGTGAATGCCTAA