Gene information

OrganismCitrobacter koseri ATCC BAA-895
HomologuedndE
GID1097
PID2097
locus tagCKO_03495
length348 bp
G+C%0.376
link  gi:157144296  
SequenceATGTTACCTAATCGTTTGCAACTGAACATTCGTGTTGAAGATCAACTTAAAAGACTAAAAGCTAGCACGG
GGGTTAATCCAAATATTTCTGCTCGGATAGCATTTTTCCGTTCTGTAGAAAGTGGCTATCGTTTTGACGG
AAATGACTATAAAACTGATGGCAATATGAGTATGGATAAAGCTGTATGGTTGGGAGATACAGGTGTAGCT
ACTGAACTTATATTGAAGATGTTGTATCCCAATTTTGATGGAAAAAAAATGATGCAAGCTTGGGCTGCAC
ATGTTGACGATGGGTCTGCATCCTTGCGAAACCATCGTGAATTAATTAGTTTTACTACATCTCTTTAA