Summary Sequence Alignment 16S rRNA Context  
5 homologues found:

HomologuedndA
OrganismStreptomyces lividans 1326
GID1001
PID2001
Locus tagSLG80
Locations85394..86587
Length1194 bp
G+C%66
Link NCBI: gi:145244267  
SequenceATGACGTACGGGACGTGCAGATTAACGCTCAAAGGTGGATTGGGTTCGATGGTGACGTACCTCGATGCGG
CGGCGACGACGCGCGTGGACCAGCGGGTGGCCGATATTGTTCTGCACTGGATGACCGCGGAGTTCGGCAA
CGCCGGCAGCCGCCACGAGTACGGCATCCGGGCCAAGCGCGGGGTAGAGCGGGCCCGTGAGTACCTGGCG
AGCACAGTGAGCGCGGAGCCTGACGAGCTGATCTTCACCAGCGGCGCCACGGAGAGCAACAATATCGCCC
TGCTGGGGCTCGCCCCCTACGGCGAGCGCACCGGCCGGCGCCACATCATCACCTCCGCCATCGAGCACAA
GGCGGTCCTTGAGCCGCTGGAGCACCTGGCCGGCCGCGGGTTCGAAGTCGACTTCCTCACGCCCGGCCCC
TCCGGCCGGATCTCGGTGGAAGGGGTGATGGAACGGCTGCGGCCAGACACCCTCCTGGTGTCTCTCATGC
ATGTGAACAACGAGACCGGTGTGATCCAGCCGGTCGCCGAGCTCGCGCAGCAGCTGCGGGCCACCCCCAC
CTACCTGCATGTGGACGCCGCCCAGGGGTACGGCAAGGTACCCGGCGACCTCACTACCCCCATCGACATG
ATCAGCATCAGCGGGCACAAGATCGGTGCTCCCAAGGGTGTGGGAGCGCTGGTCACCCGCCGCCGCGAGG
AGATGGACGACGAGCGCGTCCCCCTCGAGCCCATCATGTTCGGCGGCGGCCAGGAGCGGAAACTGCGTCC
CGGTACCCTGCCTGTTCCTCTGATCATGGGGCTGGCCGAGGCAGCGAAGATCTTCGAAGCCGAGCACGCC
CAGTGGCAGGTCGCTGCCCAGGATCTGCGTTCCCGGCTCCTGGCCGGGCTTGCCTCCACAAGCTTCCAGG
TCAACGGTGACCAGGATCACGTTGTTCCGCACATCCTCAATCTGTCCTTCGAGGACGTGGACGCCGAGGC
ATTCCTCGTCACTCTCAAAGACCTGGTTGCGGTTGCGACCGGCTCGGCGTGCACCAGCGCCTCCTTCACA
CCCAGTCATGTGCTCCGTGCCATGGGACTGCCCGAGGAGGCGGCCTCGAAGAGTTTGCGCTTCTCCTGGA
CCCCCGGGCAGGCAACAGACTTGGACGTGGAGGAGCTGGCCCGAGGCGTCGCGAAGCTGAAGCCGAGCTA
TTGA

HomologuedndB
OrganismStreptomyces lividans 1326
GID1010
PID2010
Locus tagSLG79
Locations84236..85174
Length939 bp
G+C%65
Link NCBI: gi:145244267  
SequenceTTGAACAAGGGACGACTGCCAGCGCTGACGCGCTACCTCGTCGACAACCCCACCGACTACGTCTTCAGTG
CGCTGACCGCCTCCGTCGACGGTGACATGCGCTTCGAAGGCATCGCGGACAGCGGCGTAGGGATGCGGGC
CGGCCAGATCGTGATCTCGATGGCTGCCCGATTCCTGATCAACGACGGTCAGCACCGGCGTGCTGCGATC
GAGCAGGCGCTGAAGGAGAACCCCGACCTGGGCGAGGAGACCATCGCCGTGGTCTTCTTCCACGACGCCG
GACTCGCCCGCTGTCAGCAGATGTTCGCCGACTTGAACCGGCATGCCGTACGGCCGCCGCGCTCCATCGG
GGTTCTGTACGACCATCGTGACGATCTGGCGACCACGGTGCGGCTGCTGGCGATGCGTGCGCCAGTGTTC
AAGGGCTTTGTGGAGATGGAAAGTTCCACGCTGTCCCAGCGCTCGCGCAAGCTGTTCACCTTGAGCTCTG
TGTACTACGCCACCCAGTCCTTGCTGCAGGGCTTGGAGATCACGAAGGACCAGTCCCGGGAGCTGGCTGA
GGCGTACTGGGCCGCGGTCGATGCGGTGATCCCGGAGTGGAAGCTGGTCCGACGCAGGGAGCTGTCGGCG
CAAGACGTCCGCCGCGACTACCTGCACACTCACGGGATCGCACTGCACGCGCTGGGGCGGGTAGGTAATT
CGCTGCTGCGCAAGTCACTGGCGCCGCGAAGCTGGACGCCGGCGCTTAAGCGCCTGTCGTCGGTGGACTG
GTCGCGCGCCAACACCGACTGGGAGGGGCGCGCGCTGGTCGGCGGACGGGTATCCAAGAGCCACCAAAAC
TTGACCTTGACCGTGAACTACTTGCGTCAGCACCTGAAGCTCGAGCTGAGCGCCGAGGAACAGCGTGCAG
AAGACGCCTACCTGCGAGGAGAGTCATGA

HomologuedndC
OrganismStreptomyces lividans 1326
GID1028
PID2028
Locus tagSLG78
Locations82743..84239
Length1497 bp
G+C%65
Link NCBI: gi:145244267  
SequenceATGAGCACCCCCAAGGCGGCGGCGCCTTTCCAGGACCGGCCCCTGGCAGAGATCGTCGAGGAGCTGACGG
AGGAGATCCGCGAGCTCTACGTCGCTGATGAGGTGCCGTGGGTGGTCGGGTACAGCGGCGGCAAGGACTC
CACCGCCGTCCTCCAACTGGTCTGGCTCGCGCTCAAGGACCTACCGGCCGAACAGCGCACGAAGCCGGTG
CATGTGATCAGCACGGACACCCTGGTGGAGAACCCCGTCGTCGCTGCATGGGTAGGCCAGTCCCTGGACA
CCATGCGCACCGCCGCGCAGGAACAGCAGCTGCCCATCGAGTCGCACAAACTGACCCCGGAGATCAAAGA
CACCTTCTGGGTCAGCCTGATCGGCAAGGGCTACCCTGCACCCCGCCCGAAGTTCCGGTGGTGCACCGAG
CGGTTGAAGATCAAGCCATCGAACGCCTTCATCCGGCGCGTCGTACGCCGGCACGGCGAGGCGATCCTCG
TACTGGGAATCCGCAAGGCCGAAAGCCAAGCACGGGCACGGGCGATGGCCCGGCACGAGAAGGGGCGGGT
CCGTGACCGGCTCTCACCCAACGGCAACCTCCCCAACTCCCTTGTCTACAGCCCCATCGAGGCGTGGTCG
ACCGAGGAGGTCTGGGCGTTCTTGATGCAATACCCCAATCCGTGGGGCCACAAGAACAAGGATCTGCTGA
CCATGTACCAGGGTGCGTCGGACGACTCTGAGTGCCCGCTGGTCGTCGACGACACCACCCCCTCGTGCGG
TGACAGCCGCTTCGGATGCTGGACCTGCACGCTGGTGGAGCAGGACAAGTCGATGACCGCCATGATCCGC
AACGACGACGAGAAGCAGTGGATGCGGCCGTTGCTCAAGCTCCGCAACGAGCTCGACGACGTCACCAAGG
AAGCTCAAACACGGGACTTCCGCCGCATGAACGGCAACGTGCAGCTGTTCGGCGACCGGCCCATCCCCGG
CCCATACAAGCAGTCCGCCCGCGAAGACTGGCTGCGCAAGCTCCTCGCCGCCCAAGCCCAGGTCCGCAAG
AAGGCACCCGAGCACGTGCGTAACATTGAGCTGATCTCGATGGCGGAGCTGCAGGAGATCCGGCGGATCT
GGGTCTTCGAGAAGCACGAAGTCGAGGACTCCCTGCCGCAGATCTACGAGCAGGCGACCGGCGAGAAGTT
CCCCGGACTGCCGCTCGACGAGCAGCTCGTCCTGGGCGCCGAGGAGATCGGCCTGCTCAAGGAGGCCTGC
GAGGACGATCCGATCCACTTCTCGATGACCCGTGAGCTCCTCGCGATCGAGCGCCAGTATCGAACCATGA
CCCGGCGGGCCGGCCTCTTCGAGGCCCTGGAGAAGGCGATCAAGAAGGGCTACTACGAGGACGCGGACGA
CGCGCTGCGGTTCGCCAAGCGGCTGCAGGAAATGCGCGAGAGCGACCCGACACAGACGACGGCGGACGAA
GAGATCACCACCGATGCACCTGCATAA

HomologuedndD
OrganismStreptomyces lividans 1326
GID1046
PID2046
Locus tagSLG77
Locations80765..82651
Length1887 bp
G+C%67
Link NCBI: gi:145244267  
SequenceTTGAACGGCTGCGGCAAGACGACCCTGCTCGACGCCATCCAGCTCGTGCTGTATGGGCCCAGGGCCCGCT
GCAGCGGGCGCGGTAACCGCTCGTACGACACCTACCTGCGTGAGAGCATCAACCGGGCAGCCGACCCGCA
GCGGGGCGCCGAGCTGCGGCTGGAGTTCTCAATCACCGTCGAGGGCCGTCCCCGCACCTACGAGGTGGCC
CGCACCTGGTTCGCCAAGGGCAAGCAGGTGCGGGAGAGCCTCGCCGTCACCGTGGACGGCAAGTACGACG
ACACGATCAGCGAGACATGGGCTGAGCACGTCGAGGAGATCCTCCCCCTCGAGGTGGCGTCGCTGTTCTT
CTTCGACGGCGAGAAGGTGGAACAGCTCGCCGACCCCGAGCGCGCCGCCGACGTCATCGAAGCTGCCGTC
CAGTCCCTTCTCGGCGTCAGGGCCGTCGAACAGCTGCGGACTGACCTGCTCGCCCTCCAGCGCCGCCAAC
GGCTGTCGCAGGAGGATCAGGGCATTCTGGAGCAGATCCGCGACCTCAAGGTCAAGTCACAGGCCGCGGC
CCAGGAGGTCTCCGACCAGAGCCAGCTCCTGGCGCAGGCCACCTCGCACCTGGACGTCGCCCAGGCACAG
CTCGCCAAGATAGAGCGCGACTTCGAACGCGCCGGGGGAAGGCTCTACGAGGAGCGGCGCGGGCTCGAGG
CTGCGAAGGAGGCCACGGCTGAGCGTCTGGCCCAGACGCAAAAGGACCTTCGGGGCCTCGCCGAGGGGCC
CCTGCCACTCCTGCTGCTACGCGGGGAACTGGCTGCACTGCAGGAACAGTCCGTACGCGAGCAGGAGGCG
GCCGAAGCTCGTCAGGTCATCGGCGTCCTCGAGAGGCGTGACGCCTGGCTGGTCGACCAGCTGCCGGACG
GCGTACCCGCCGCAGACCGCACGGCGCTGAAGAGGAAACTGACCGCAGACCGCAAGAAGCGCGCAGCAGC
CACCGAACTGGCCCTGGACCTGTCTCTGCCGCCCGATCTCCCGCAGAAACTGGCGGCGCTCGACGAGGTG
CTGGAAACGGACGCAGCCCGCGCGGCAGAACTTCTTCGCTCCGCCGACAAAACCGTGCACGAACTTCAGC
AGGCCGAGCGCCAGTTGGCGGCCGTGCCCGACGAGCAGCAGATCAAGACTCTGATCGAAGACCGTCAGCA
GGCCTCCGAGGCGGTCATCGTCGCCCGCGCCGCAGTGGAGCAGCACAGAGAGCTGGTCGCGGAGGCCAGG
TCCCGACATGAGCGTCTCGAAGCTGACCTGGAGCGCGCGCGACAGAAGATGGTCAGGACTTTCGTCCGCG
AGGAGGAGCTCCAGCGCGTCGTCGCCTATGCAGACAAGGCCCGCACCACGTTGGATCGGTTCGGCGAGGC
GCTCCTGCGTAAGCACATCAGCAGCCTGGAAGTAGCTGTGCTGCGCAGCTTCCAGACGCTGATGCGCAAG
AGCGGGCTGATCAAGGACCTGCGGATCGATACCAACAAGTTCACGCTCGCGCTGACCAACCGCGACGAGG
AACCCCTCGACCCCGCCCGGCTCAGCGCGGGAGAGCGGCAACTGCTGGCCATCTCGCTGCTATGGGGGCT
GGCTAAAGTCGCGGGCAACCGTCTACCCACAGTGATCGACACCCCACTCGGGCGTCTGGACAGCCGCCAT
CGCGAACACCTCGTCGACCGGTACTTCCCCCACGCCGGCCGACAGGTCCTCCTCTTGTCCACAGACGAGG
AGATCGACGAGCATCTCCTTCAGCGGCTGAGGCCGTCCATTGCCCACAGTTACGTCCTCGTGCACGACGA
CACCACGTTCACCACCCGCGTCGCGGAGGGCTACTGGTGGACCGAGGGAGCCTTGCATGCCGTCTGA

HomologuedndE
OrganismStreptomyces lividans 1326
GID1064
PID2064
Locus tagSLG76
Locations80395..80775
Length381 bp
G+C%65
Link NCBI: gi:145244267  
SequenceATGCCGTCTGAGATCACCATCCGGCTGTCCCAAGCCGCAAAGGACCAGCTGTCCTGGCTCAAGCGCCACA
CGGGCCTGACCCAGTGGAACGAACTGTGCCGGTGGGCGCTGGCGCTTTCCCTGCGCGACCCCTCTACCCC
CCTCGTGCGAGAGATCATCACTGACTCCAACGTCGAGATCGCCTGGAAGACCTTCGCTGGCCCGCACGGT
GACATCTACCTGGCCCTGCTCAAGCAAAGGTGCGTCGCGGATGGGGACGAGCCCACCGACGCCGCCGTGG
GCAAGACGCTGCTTATCCACCTGCACCGCGGCATCGGCTTCCTCGCCGGACGCCAAGACTTGCGCTCCAT
CCAGAACCTCATTGCCGTCACCGCCGAATAG