Summary Sequence Context  
1 homologue found:

HomologuedndA
OrganismStreptomyces lividans 1326
GID1001
PID2001
Locus tagSLG80
Locations85394..86587
Length1194 bp
G+C%66
Link NCBI: gi:145244267  
SequenceATGACGTACGGGACGTGCAGATTAACGCTCAAAGGTGGATTGGGTTCGATGGTGACGTACCTCGATGCGG
CGGCGACGACGCGCGTGGACCAGCGGGTGGCCGATATTGTTCTGCACTGGATGACCGCGGAGTTCGGCAA
CGCCGGCAGCCGCCACGAGTACGGCATCCGGGCCAAGCGCGGGGTAGAGCGGGCCCGTGAGTACCTGGCG
AGCACAGTGAGCGCGGAGCCTGACGAGCTGATCTTCACCAGCGGCGCCACGGAGAGCAACAATATCGCCC
TGCTGGGGCTCGCCCCCTACGGCGAGCGCACCGGCCGGCGCCACATCATCACCTCCGCCATCGAGCACAA
GGCGGTCCTTGAGCCGCTGGAGCACCTGGCCGGCCGCGGGTTCGAAGTCGACTTCCTCACGCCCGGCCCC
TCCGGCCGGATCTCGGTGGAAGGGGTGATGGAACGGCTGCGGCCAGACACCCTCCTGGTGTCTCTCATGC
ATGTGAACAACGAGACCGGTGTGATCCAGCCGGTCGCCGAGCTCGCGCAGCAGCTGCGGGCCACCCCCAC
CTACCTGCATGTGGACGCCGCCCAGGGGTACGGCAAGGTACCCGGCGACCTCACTACCCCCATCGACATG
ATCAGCATCAGCGGGCACAAGATCGGTGCTCCCAAGGGTGTGGGAGCGCTGGTCACCCGCCGCCGCGAGG
AGATGGACGACGAGCGCGTCCCCCTCGAGCCCATCATGTTCGGCGGCGGCCAGGAGCGGAAACTGCGTCC
CGGTACCCTGCCTGTTCCTCTGATCATGGGGCTGGCCGAGGCAGCGAAGATCTTCGAAGCCGAGCACGCC
CAGTGGCAGGTCGCTGCCCAGGATCTGCGTTCCCGGCTCCTGGCCGGGCTTGCCTCCACAAGCTTCCAGG
TCAACGGTGACCAGGATCACGTTGTTCCGCACATCCTCAATCTGTCCTTCGAGGACGTGGACGCCGAGGC
ATTCCTCGTCACTCTCAAAGACCTGGTTGCGGTTGCGACCGGCTCGGCGTGCACCAGCGCCTCCTTCACA
CCCAGTCATGTGCTCCGTGCCATGGGACTGCCCGAGGAGGCGGCCTCGAAGAGTTTGCGCTTCTCCTGGA
CCCCCGGGCAGGCAACAGACTTGGACGTGGAGGAGCTGGCCCGAGGCGTCGCGAAGCTGAAGCCGAGCTA
TTGA