Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismStreptomyces lividans 1326
GID1010
PID2010
Locus tagSLG79
Locations84236..85174
Length939 bp
G+C%65
Link NCBI: gi:145244267  
SequenceTTGAACAAGGGACGACTGCCAGCGCTGACGCGCTACCTCGTCGACAACCCCACCGACTACGTCTTCAGTG
CGCTGACCGCCTCCGTCGACGGTGACATGCGCTTCGAAGGCATCGCGGACAGCGGCGTAGGGATGCGGGC
CGGCCAGATCGTGATCTCGATGGCTGCCCGATTCCTGATCAACGACGGTCAGCACCGGCGTGCTGCGATC
GAGCAGGCGCTGAAGGAGAACCCCGACCTGGGCGAGGAGACCATCGCCGTGGTCTTCTTCCACGACGCCG
GACTCGCCCGCTGTCAGCAGATGTTCGCCGACTTGAACCGGCATGCCGTACGGCCGCCGCGCTCCATCGG
GGTTCTGTACGACCATCGTGACGATCTGGCGACCACGGTGCGGCTGCTGGCGATGCGTGCGCCAGTGTTC
AAGGGCTTTGTGGAGATGGAAAGTTCCACGCTGTCCCAGCGCTCGCGCAAGCTGTTCACCTTGAGCTCTG
TGTACTACGCCACCCAGTCCTTGCTGCAGGGCTTGGAGATCACGAAGGACCAGTCCCGGGAGCTGGCTGA
GGCGTACTGGGCCGCGGTCGATGCGGTGATCCCGGAGTGGAAGCTGGTCCGACGCAGGGAGCTGTCGGCG
CAAGACGTCCGCCGCGACTACCTGCACACTCACGGGATCGCACTGCACGCGCTGGGGCGGGTAGGTAATT
CGCTGCTGCGCAAGTCACTGGCGCCGCGAAGCTGGACGCCGGCGCTTAAGCGCCTGTCGTCGGTGGACTG
GTCGCGCGCCAACACCGACTGGGAGGGGCGCGCGCTGGTCGGCGGACGGGTATCCAAGAGCCACCAAAAC
TTGACCTTGACCGTGAACTACTTGCGTCAGCACCTGAAGCTCGAGCTGAGCGCCGAGGAACAGCGTGCAG
AAGACGCCTACCTGCGAGGAGAGTCATGA