Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismStreptomyces lividans 1326
GID1028
PID2028
Locus tagSLG78
Locations82743..84239
Length1497 bp
G+C%65
Link NCBI: gi:145244267  
SequenceATGAGCACCCCCAAGGCGGCGGCGCCTTTCCAGGACCGGCCCCTGGCAGAGATCGTCGAGGAGCTGACGG
AGGAGATCCGCGAGCTCTACGTCGCTGATGAGGTGCCGTGGGTGGTCGGGTACAGCGGCGGCAAGGACTC
CACCGCCGTCCTCCAACTGGTCTGGCTCGCGCTCAAGGACCTACCGGCCGAACAGCGCACGAAGCCGGTG
CATGTGATCAGCACGGACACCCTGGTGGAGAACCCCGTCGTCGCTGCATGGGTAGGCCAGTCCCTGGACA
CCATGCGCACCGCCGCGCAGGAACAGCAGCTGCCCATCGAGTCGCACAAACTGACCCCGGAGATCAAAGA
CACCTTCTGGGTCAGCCTGATCGGCAAGGGCTACCCTGCACCCCGCCCGAAGTTCCGGTGGTGCACCGAG
CGGTTGAAGATCAAGCCATCGAACGCCTTCATCCGGCGCGTCGTACGCCGGCACGGCGAGGCGATCCTCG
TACTGGGAATCCGCAAGGCCGAAAGCCAAGCACGGGCACGGGCGATGGCCCGGCACGAGAAGGGGCGGGT
CCGTGACCGGCTCTCACCCAACGGCAACCTCCCCAACTCCCTTGTCTACAGCCCCATCGAGGCGTGGTCG
ACCGAGGAGGTCTGGGCGTTCTTGATGCAATACCCCAATCCGTGGGGCCACAAGAACAAGGATCTGCTGA
CCATGTACCAGGGTGCGTCGGACGACTCTGAGTGCCCGCTGGTCGTCGACGACACCACCCCCTCGTGCGG
TGACAGCCGCTTCGGATGCTGGACCTGCACGCTGGTGGAGCAGGACAAGTCGATGACCGCCATGATCCGC
AACGACGACGAGAAGCAGTGGATGCGGCCGTTGCTCAAGCTCCGCAACGAGCTCGACGACGTCACCAAGG
AAGCTCAAACACGGGACTTCCGCCGCATGAACGGCAACGTGCAGCTGTTCGGCGACCGGCCCATCCCCGG
CCCATACAAGCAGTCCGCCCGCGAAGACTGGCTGCGCAAGCTCCTCGCCGCCCAAGCCCAGGTCCGCAAG
AAGGCACCCGAGCACGTGCGTAACATTGAGCTGATCTCGATGGCGGAGCTGCAGGAGATCCGGCGGATCT
GGGTCTTCGAGAAGCACGAAGTCGAGGACTCCCTGCCGCAGATCTACGAGCAGGCGACCGGCGAGAAGTT
CCCCGGACTGCCGCTCGACGAGCAGCTCGTCCTGGGCGCCGAGGAGATCGGCCTGCTCAAGGAGGCCTGC
GAGGACGATCCGATCCACTTCTCGATGACCCGTGAGCTCCTCGCGATCGAGCGCCAGTATCGAACCATGA
CCCGGCGGGCCGGCCTCTTCGAGGCCCTGGAGAAGGCGATCAAGAAGGGCTACTACGAGGACGCGGACGA
CGCGCTGCGGTTCGCCAAGCGGCTGCAGGAAATGCGCGAGAGCGACCCGACACAGACGACGGCGGACGAA
GAGATCACCACCGATGCACCTGCATAA