Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismStreptomyces lividans 1326
GID1046
PID2046
Locus tagSLG77
Locations80765..82651
Length1887 bp
G+C%67
Link NCBI: gi:145244267  
SequenceTTGAACGGCTGCGGCAAGACGACCCTGCTCGACGCCATCCAGCTCGTGCTGTATGGGCCCAGGGCCCGCT
GCAGCGGGCGCGGTAACCGCTCGTACGACACCTACCTGCGTGAGAGCATCAACCGGGCAGCCGACCCGCA
GCGGGGCGCCGAGCTGCGGCTGGAGTTCTCAATCACCGTCGAGGGCCGTCCCCGCACCTACGAGGTGGCC
CGCACCTGGTTCGCCAAGGGCAAGCAGGTGCGGGAGAGCCTCGCCGTCACCGTGGACGGCAAGTACGACG
ACACGATCAGCGAGACATGGGCTGAGCACGTCGAGGAGATCCTCCCCCTCGAGGTGGCGTCGCTGTTCTT
CTTCGACGGCGAGAAGGTGGAACAGCTCGCCGACCCCGAGCGCGCCGCCGACGTCATCGAAGCTGCCGTC
CAGTCCCTTCTCGGCGTCAGGGCCGTCGAACAGCTGCGGACTGACCTGCTCGCCCTCCAGCGCCGCCAAC
GGCTGTCGCAGGAGGATCAGGGCATTCTGGAGCAGATCCGCGACCTCAAGGTCAAGTCACAGGCCGCGGC
CCAGGAGGTCTCCGACCAGAGCCAGCTCCTGGCGCAGGCCACCTCGCACCTGGACGTCGCCCAGGCACAG
CTCGCCAAGATAGAGCGCGACTTCGAACGCGCCGGGGGAAGGCTCTACGAGGAGCGGCGCGGGCTCGAGG
CTGCGAAGGAGGCCACGGCTGAGCGTCTGGCCCAGACGCAAAAGGACCTTCGGGGCCTCGCCGAGGGGCC
CCTGCCACTCCTGCTGCTACGCGGGGAACTGGCTGCACTGCAGGAACAGTCCGTACGCGAGCAGGAGGCG
GCCGAAGCTCGTCAGGTCATCGGCGTCCTCGAGAGGCGTGACGCCTGGCTGGTCGACCAGCTGCCGGACG
GCGTACCCGCCGCAGACCGCACGGCGCTGAAGAGGAAACTGACCGCAGACCGCAAGAAGCGCGCAGCAGC
CACCGAACTGGCCCTGGACCTGTCTCTGCCGCCCGATCTCCCGCAGAAACTGGCGGCGCTCGACGAGGTG
CTGGAAACGGACGCAGCCCGCGCGGCAGAACTTCTTCGCTCCGCCGACAAAACCGTGCACGAACTTCAGC
AGGCCGAGCGCCAGTTGGCGGCCGTGCCCGACGAGCAGCAGATCAAGACTCTGATCGAAGACCGTCAGCA
GGCCTCCGAGGCGGTCATCGTCGCCCGCGCCGCAGTGGAGCAGCACAGAGAGCTGGTCGCGGAGGCCAGG
TCCCGACATGAGCGTCTCGAAGCTGACCTGGAGCGCGCGCGACAGAAGATGGTCAGGACTTTCGTCCGCG
AGGAGGAGCTCCAGCGCGTCGTCGCCTATGCAGACAAGGCCCGCACCACGTTGGATCGGTTCGGCGAGGC
GCTCCTGCGTAAGCACATCAGCAGCCTGGAAGTAGCTGTGCTGCGCAGCTTCCAGACGCTGATGCGCAAG
AGCGGGCTGATCAAGGACCTGCGGATCGATACCAACAAGTTCACGCTCGCGCTGACCAACCGCGACGAGG
AACCCCTCGACCCCGCCCGGCTCAGCGCGGGAGAGCGGCAACTGCTGGCCATCTCGCTGCTATGGGGGCT
GGCTAAAGTCGCGGGCAACCGTCTACCCACAGTGATCGACACCCCACTCGGGCGTCTGGACAGCCGCCAT
CGCGAACACCTCGTCGACCGGTACTTCCCCCACGCCGGCCGACAGGTCCTCCTCTTGTCCACAGACGAGG
AGATCGACGAGCATCTCCTTCAGCGGCTGAGGCCGTCCATTGCCCACAGTTACGTCCTCGTGCACGACGA
CACCACGTTCACCACCCGCGTCGCGGAGGGCTACTGGTGGACCGAGGGAGCCTTGCATGCCGTCTGA