Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismStreptomyces lividans 1326
GID1064
PID2064
Locus tagSLG76
Locations80395..80775
Length381 bp
G+C%65
Link NCBI: gi:145244267  
SequenceATGCCGTCTGAGATCACCATCCGGCTGTCCCAAGCCGCAAAGGACCAGCTGTCCTGGCTCAAGCGCCACA
CGGGCCTGACCCAGTGGAACGAACTGTGCCGGTGGGCGCTGGCGCTTTCCCTGCGCGACCCCTCTACCCC
CCTCGTGCGAGAGATCATCACTGACTCCAACGTCGAGATCGCCTGGAAGACCTTCGCTGGCCCGCACGGT
GACATCTACCTGGCCCTGCTCAAGCAAAGGTGCGTCGCGGATGGGGACGAGCCCACCGACGCCGCCGTGG
GCAAGACGCTGCTTATCCACCTGCACCGCGGCATCGGCTTCCTCGCCGGACGCCAAGACTTGCGCTCCAT
CCAGAACCTCATTGCCGTCACCGCCGAATAG