Summary Sequence Alignment 16S rRNA Context  
5 homologues found:

HomologuedndA
OrganismStreptomyces avermitilis MA-4680
GID1002
PID2002
Locus tagSAV_2933
Locations3677808..3678962
Length1155 bp
G+C%64
Link NCBI: gi:162960844  
SequenceGTGAGCGCCGTGGTGGCGTATCTGGATGTTGCGGCGACGACACGGGTGGATCCCCGGGTAGCCGAGGTCG
TCCTGCACTGGATGACAGAGGACTTCGGCAACGCCGGCAGCCGCACCCATGAATACGGCGCCCGCGCCAA
GAAGGCTGTCCAGCAAGCCCGTTCCTATCTCGCGGACACCGTAGGCGCGAAGACCGAGGAAGTGATCTTC
ACCAGCGGGGCGACGGAGTCCAACAACATCGCCCTGCTCGGCCTCGCTCCACATGGCGAGCGGACCGGCA
AGAAGCACATCATCACCTCCGCCATCGAACACAAGGCCGTCCTCGAGCCCCTGTTGCACCTCGCGGAAAC
CCGCGGCTTCACCGTGGACGTTCTTGAGCCGGGTGCGTCAGGCCGAATCACTGTCGAGCAGGTCATGGAG
CACGTGCGCCCCGACACACTCGCGGTGTCTCTGATGCACGTCAACAACGAGACCGGAGTCATCCAGCCGG
TCGCCGAGCTAGCCGAGCGCCTGCGGTCCACGCCGACCTACCTCCACGTGGACGCCGCCCAGGGATACGG
CAAGATCGCCGGCGATCTGACCGCGCCAATCGACCTGATCAGCATCAGCGGCCACAAGATCGGCGCACCG
AAGGGGGTCGGAGCGCTCATCACACGACGTCGCGGCTGGGATAAGGCTCCACTGGAGCCGATCATGTTCG
GCGGTGGCCAGGAGAGGAAGCTGCGTCCCGGAACTCTGCCGGTCCCGCTGATCATGGGCCTCCACGAGGC
CGCGCGGATCTTCCACGAGAGCCGGGATAACTGGGAGCGCGAGGCACGAGCGATGCGTGAGCAGATCTTG
GAAGCGCTCGGCAAGACACGCTTCCGGGTCAACGGAGATCAGGCTCACACCGTGCCGCACATCCTCAATG
TCTCCTTCGACCAGCTCAACGCTGAAGCCTTGATTGTCCGACTCAAGGATCAGGTCGCCATTGCAACAGG
TTCGGCGTGCACCAGCGCCTCCTACACCCCTAGCCACGTGCTCCAGGCTATGGGCCTTCCCGATGACGTG
GCTGCCAATGGGCTGCGGTTTTCCTGGTTCCCTCCGCAAGCGAGGGACTTCGACCCTCTTCCCATTGCCG
AAACCATTGCCCGCATGCAGCCTCAGGAAGGCTGA

HomologuedndB
OrganismStreptomyces avermitilis MA-4680
GID1011
PID2011
Locus tagSAV_2932
Locations3676424..3677563
Length1140 bp
G+C%63
Link NCBI: gi:162960844  
SequenceGTGCAGACTGAAGCGGCGAGCAAGACTGCGGGGCGGGCTGCCACGCGAGCGTCAACGGGCTTTGAATACA
CCTTTCCTGCGATCCGTGGAGTGCAGGCGGGGCGGGAGTTCTATGCGTCGATGTGCCCGCTGCGGCTCAT
CCCGAAGATCTTCCTCTTCGACGAAGATGATCTTTCCGCTGAGCTGAGAGCCCAGCGGGTGCTTAATAAG
GGACGCCTGCCGGCGCTCGCTCGCTACATTCTGGACAATCCCGACGATTACGTCTTCAGTGCCCTGACCG
CGTCCGTGGACGGGGATATGGCCTTCGAATGTCAGGGCGCAGAGGGTTCTGCGCACCGCACGGGGCAGTT
GCGCATCCCCATGGATGCCCGCTTCCTGATCAACGACGGACAGCATCGCCGCGCCGCCATCGAGCTCGCG
CTGAAGGAGAAGCCTGACCTCGGGGACGAGACCATCGCTGTCGTCTTCTTCCATGACACTGGCCTCTCTC
GCTCCCAGCAGATGTTCGCCGACCTCAACCGGCATGCCGTCCGCCCGGCGCGCTCCATCGGGGTCCTGTA
CGACCACCGGGACCTCAACGCTCAGATCACGCGCGCCCTCACGGAACGCTCAGCCATCTTCAAGGGCTTT
GTTGAGATGGAGAAGAGCACGCTCTCCGCTCGCTCGCGCAAGCTGTTCACTCTTAGCGCCCTGTATTACG
GCAACCAGTCCCTCCTTCAAGGCCTCGACCTCAAGCAGGACGAGGCGATCAAGCTGACGCAGTCGTTCTG
GGAAGCCGTGGACACGGCGCTGCCGGAGTGGGCGATGGTCCGCGGTAAGCAGCTTTCCGCCCAGGAGATG
CGTCGGGACTTCATCCACAGCCACGGCATCGCCCTGCATGCGCTGGGCCGCGTTGGAAACGCGCTGTTGC
GGGAGTCGGTCAAGGAGGCTGCATGGAAGAGGCGGTTGGTTCCGCTGACGGATGTGGACTGGACCCGGGG
CAACATCGACTGGGAGGGGCGTGCCATCGTCGGCGGCCGCGTTTCCAAAAGCCATCAAAACGTGACATTG
ACCGTTAATTACCTGCGTAAGCATCTGGGCCTGGAGTTGAGCCCGGAAGAGCGGCGCGTGGAAGACGCAT
ATCTGCGAGGCGAGGCATGA

HomologuedndC
OrganismStreptomyces avermitilis MA-4680
GID1029
PID2029
Locus tagSAV_2931
Locations3674850..3676427
Length1578 bp
G+C%62
Link NCBI: gi:162960844  
SequenceATGACCACCATCCCCCTCAACCTCGGGCTTACCCCCGTACGTCGCAAGCCGTTCGGTGGACGCTCCCTGG
AGGAGGTCGTCAACGAACTGACGGAGGAGATCCGGGAGCTCTACACCGCCGACCAGGTGCCCTGGGTCAT
CGGCTACAGCGGGGGTAAGGATTCCACTGCTGTCCTGCAGCTGGTGTGGATGGCTCTCAAGGGCCTGCCT
GCCGAGCAACGCACCAAGGCTGTGCATGTCATTAGCACCGACACGCTTGTGGAGAACCCGGTCGTTGCCG
CCTGGGTGTCCGCCTCGCTGGGCACCATGCAGGATGCGGCGCAGGCGCAGGGTCTGCCGGTCGAGCCGCA
CCGCCTGACTCCGGAGATCAAGGACACCTTTTGGGTGAACTTGCTTGGCCGGGGCTATCCCGCCCCGCGC
CCGAAGTTCCGCTGGTGCACCGAACGTCTGAAGATTAAGCCGTCGAACGCCTTCATCCGCAGTGTGGTCG
CCGCTCACGGCGAGGCGATTATGGTCCTGGGTATCCGTAAAACGGAGAGCCAAGCCCGCGCCCGCGCCAT
GGAAAAGCACGAGAAGCGCCGCGTCCGCGACCGCCTCTCACCCAACGCAAACCTGCCCAACTCCCTCGTC
TACAGCCCCGTTGAGGACTGGACCAACGACGACGTGTGGGAGTTCCTGATGCAAAAGCCCAATCCCTGGG
GCTACACCAATCAGGACCTGCTCACTATGTATCAGGGCGCTTCCAGTGATGGCGAATGCCCGCTCGTGGT
CGACTCCACTACTCCTTCCTGTGGCTCAAGCCGTTTCGGCTGCTGGACCTGCACCCTCGTCGATGAGGAC
AAGTCCATGTCCGCCATGATCCAGAACGACGAGGAAAAGGAGTGGATGACCCCTCTGTTGGAGCTACGTA
ATAAGCTCGACGCCCCATTTGATGAATGGAAAGAGGGCGAGGAAATTCCGGCTGGCCGCAAGGTTGGCGA
TCCTAAGCCTGACAAGCCGGCTCGCGACTTCCGTCGGATGAACGGCAAGGTCATGCTGTTCAAGGACGAC
GCCATCCACGGGCCTTATCTGCAGTCCTTCCGCGAAGAGTGGTTGAAGGACCTGCTGGACGCCCAGACTT
GGATCCGTGCCCATGCTCCGGAGCACGTGCAGAACATCGAGCTGATCACGCTTGAGGAACTGCACGAGAT
CCGCCGGATCTGGGTGTTCGACAAGCACGAGGTCGAAGACAGCCTGCCGCGGATCTACCAGGAGGCCACC
GGCGAGTCCTTCCCGGGTGGCCCGCTCGACGAGCAACTCGTCATGGGGTCCGACGAGATGGACGTCCTCA
AGCAGGTCTGCGATGGCGACGACCTGCATTACAACATGGTCCGCGAGCTCCTCGCCGTTGAGCGGAAGTA
CCGCACCATGGCGCGCCGTTCAGGCCTCTTCCAGGCACTCGAGCAGGCTGTGCAGAAGGGCTACTACGAA
GACCACGAAGACGCCGTGGAATTCGCCACCCGCAAACAGAAGTGGCGAGACGACATCGCCGAGAACCTGA
CCTTCGACGACGAAAACGAACTCGATGCTCCTGCGTAA

HomologuedndD
OrganismStreptomyces avermitilis MA-4680
GID1047
PID2047
Locus tagSAV_2930
Locations3672836..3674863
Length2028 bp
G+C%65
Link NCBI: gi:162960844  
SequenceATGCTCCTGCGTAAGATCACCCTCGAAGAATTCGGGGCGTACCGCGGAAAGCAGTCTCTCGACCTTACCC
CCAAGAAGAACAAGCCGATCATCCTGATCGGCGGGTTGAACGGGTGCGGCAAGACGACTCTGCTCGACGC
CATCCAGCTGGTGCTTTACGGCAACCGGGCGCGCTGCAGCGGTCGTGGCACCAAGGCCTACGAGACGTAC
CTGCGGGAGAGCATCAACCGCAAGGCCGACCCCAGCCGCGGTTCTGCCATCACCCTCGAATTCACCGTCA
TGACCGGTGGGCACGAGCACTACTACCGTCTCGTCCGCAGCTGGCACATCAGCGGTAAGACCCTCAAAGA
GTTCCTCAACGTCTACGTCGACGAGACCTATGGCGAGCGGGTGAAAGCGCAGCGCAGCGCGGAGCCGGAA
GGCAAGTTCAACCGCCTCCTCAGTGAGGGCTGGGCAGACCACGTCGAGTCGCTGCTGCCGTTGGAGATCG
CCTCCCTCGCCTTCTTCGACGGCGAGAAGATTGAGTCGCTGGCCAACCCCGAACGGGCGGCGTCCGTCAT
CGAGTCGGCCGTGCACTCCCTGCTGGGCGTCAGCACCGTCCAGCAGCTGCGCAACGATCTTCTGGCCCTC
CAGCGGCGCCAGAAGCTGTCCGAGGAGGAACAGCATCTCCTGGACAACATCCGTGCCCAGGAAGCCGAAC
GCGAAGCGGTGGTGTCCCAGTACGACATCGCGCACCAGGAACTGGCCCACTCCCGCAGCGAACTCGGCAA
GGCGCAGCGCAAGCTGGACAGCCTGGAGAAGGCGTTCGCTGACGAGGGTGGCGATCTGTTCACCCGGCGC
GTCGAGCTGGAAAACGACAGGAAGCAGGCCCTCGTCCGCCTGGCCCAGGTGCGCACGGAGCTCACGCAAC
TTGCAGCAGGACCCCTGCCGTTGTTGATGGTCGCACCGCTTCTCGACGACGTCCGGCAGCAAGCCAGAAT
CGAGCAGGAAGCCCAGCAGTCCGCCCAGGTCCTCGAGGTCCTCGAAGAGCGCGATCGGTGGCTGCTGGAG
TTGATGCCCGACGCCACCCGAGCCGAGGTCCTCAAGCGGCTGGACGACGACCGCGCCGAGCGCGCCGCCA
AGACGCAGCTGGCGGTGGATCTGCGCCTGCCGCACGACGCGCTGGCCCAGCTCACCGTCCTCGACGAACT
GCTCCAGCGGGATACCCAGCGCTCCGCGCAGCTGCTTCATAGCGCCGCTGAACTGGCCGAGCATCTGGAC
CAGCTGGATCGGCAGCTTGCCGGCGTTCCCGCACAGGACAAGGTCGAAGCCCTCCAGGCGGCCCGGGGCG
AGCAGATCGTAGAGGTAACCCGCTGTGAGACGACTCGCGACCGTGCCACAGCCAAGCTTGAGGACCTCAA
GCGGCGCCGTGAACACGTCACCACGCTGCTGGAGCGTGCGCACAAAGAGTTCGTCCGCACCAAGGTGAAG
GCGGAAGAAGTCGAGCGGGTGATCAAGTACTCGGAGAAGGCCCGCGACACTCTCGAGCGTTTCGGCTCCG
CGCTCCTTGAGCGGCACATCAGTCGGCTCGAAGTGGCCGTTCTGCAGAGCTTCAAGGTCCTCATGCGCAA
GCAGGGTCTCGTGCGCGACCTGCGCATCGATACCGACAAGTTCATCCTCACCCTGGCTGACGCCGATGGC
GAGGCCATCGATCCGGCGCGTCTGAGTGCGGGTGAGCGCCAGCTTCTGGCTGTCTCGCTGCTCTGGGGTT
TGATGCGCGTCGCCGGCAACCGGCTGCCCAGCGTCATCGACACCCCTCTGGGCCGTCTCGACAGCCGTCA
CCGCGAGCACCTCGTCGACCGCTACTTCCCCAACGCCAGCGACCAGGTTCTCCTGCTGTCCACCGACGAG
GAGATCGACGAGTATCTGCTGGGCCGCTTGGAGAAGTCCGTCGCCCACACCTACACGCTCGTCCACGACG
ACACCGAATTCACCACCGCCGTCGTCGAAGGCTACTGGTGGAGTGCAGGAGCCTCGCATGCCGGTTGA

HomologuedndE
OrganismStreptomyces avermitilis MA-4680
GID1065
PID2065
Locus tagSAV_2929
Locations3672466..3672861
Length396 bp
G+C%65
Link NCBI: gi:162960844  
SequenceGTGCAGGAGCCTCGCATGCCGGTTGACCACGTCCGTCTGTCTCAGCCGGCCAAGGATCGGCTGTCCTACC
TCAAGCGCACCACCGGCGTCACTCAGTGGAACGTGCTGTGCCGCTGGGCGCTGCTGCTGTCGCTGAGGGA
CCCTTCCACCCCGCTGGTGAAGGACATCGTCACTGACTCCAACGTTGAGATGAGCTGGAGGACCTTCGCC
GGCCAGTACGGCGACCTCTACCTGGCCCTGCTCAAGCAGCGCTGTGTCGCCATCGGTGAGGAGCCCAATG
ACGAGAACATCCAGCGCGTCCTGACCGTCCACGTGCACCGCGGCATCGGCTACCTCGGTGCCGACAAGCA
GATGGCCACGGTCGAAGGAATGGTCGGCGCCGTCGTGCCCACCTGA