Summary Sequence Context  
1 homologue found:

HomologuedndA
OrganismStreptomyces avermitilis MA-4680
GID1002
PID2002
Locus tagSAV_2933
Locations3677808..3678962
Length1155 bp
G+C%64
Link NCBI: gi:162960844  
SequenceGTGAGCGCCGTGGTGGCGTATCTGGATGTTGCGGCGACGACACGGGTGGATCCCCGGGTAGCCGAGGTCG
TCCTGCACTGGATGACAGAGGACTTCGGCAACGCCGGCAGCCGCACCCATGAATACGGCGCCCGCGCCAA
GAAGGCTGTCCAGCAAGCCCGTTCCTATCTCGCGGACACCGTAGGCGCGAAGACCGAGGAAGTGATCTTC
ACCAGCGGGGCGACGGAGTCCAACAACATCGCCCTGCTCGGCCTCGCTCCACATGGCGAGCGGACCGGCA
AGAAGCACATCATCACCTCCGCCATCGAACACAAGGCCGTCCTCGAGCCCCTGTTGCACCTCGCGGAAAC
CCGCGGCTTCACCGTGGACGTTCTTGAGCCGGGTGCGTCAGGCCGAATCACTGTCGAGCAGGTCATGGAG
CACGTGCGCCCCGACACACTCGCGGTGTCTCTGATGCACGTCAACAACGAGACCGGAGTCATCCAGCCGG
TCGCCGAGCTAGCCGAGCGCCTGCGGTCCACGCCGACCTACCTCCACGTGGACGCCGCCCAGGGATACGG
CAAGATCGCCGGCGATCTGACCGCGCCAATCGACCTGATCAGCATCAGCGGCCACAAGATCGGCGCACCG
AAGGGGGTCGGAGCGCTCATCACACGACGTCGCGGCTGGGATAAGGCTCCACTGGAGCCGATCATGTTCG
GCGGTGGCCAGGAGAGGAAGCTGCGTCCCGGAACTCTGCCGGTCCCGCTGATCATGGGCCTCCACGAGGC
CGCGCGGATCTTCCACGAGAGCCGGGATAACTGGGAGCGCGAGGCACGAGCGATGCGTGAGCAGATCTTG
GAAGCGCTCGGCAAGACACGCTTCCGGGTCAACGGAGATCAGGCTCACACCGTGCCGCACATCCTCAATG
TCTCCTTCGACCAGCTCAACGCTGAAGCCTTGATTGTCCGACTCAAGGATCAGGTCGCCATTGCAACAGG
TTCGGCGTGCACCAGCGCCTCCTACACCCCTAGCCACGTGCTCCAGGCTATGGGCCTTCCCGATGACGTG
GCTGCCAATGGGCTGCGGTTTTCCTGGTTCCCTCCGCAAGCGAGGGACTTCGACCCTCTTCCCATTGCCG
AAACCATTGCCCGCATGCAGCCTCAGGAAGGCTGA