Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismStreptomyces avermitilis MA-4680
GID1011
PID2011
Locus tagSAV_2932
Locations3676424..3677563
Length1140 bp
G+C%63
Link NCBI: gi:162960844  
SequenceGTGCAGACTGAAGCGGCGAGCAAGACTGCGGGGCGGGCTGCCACGCGAGCGTCAACGGGCTTTGAATACA
CCTTTCCTGCGATCCGTGGAGTGCAGGCGGGGCGGGAGTTCTATGCGTCGATGTGCCCGCTGCGGCTCAT
CCCGAAGATCTTCCTCTTCGACGAAGATGATCTTTCCGCTGAGCTGAGAGCCCAGCGGGTGCTTAATAAG
GGACGCCTGCCGGCGCTCGCTCGCTACATTCTGGACAATCCCGACGATTACGTCTTCAGTGCCCTGACCG
CGTCCGTGGACGGGGATATGGCCTTCGAATGTCAGGGCGCAGAGGGTTCTGCGCACCGCACGGGGCAGTT
GCGCATCCCCATGGATGCCCGCTTCCTGATCAACGACGGACAGCATCGCCGCGCCGCCATCGAGCTCGCG
CTGAAGGAGAAGCCTGACCTCGGGGACGAGACCATCGCTGTCGTCTTCTTCCATGACACTGGCCTCTCTC
GCTCCCAGCAGATGTTCGCCGACCTCAACCGGCATGCCGTCCGCCCGGCGCGCTCCATCGGGGTCCTGTA
CGACCACCGGGACCTCAACGCTCAGATCACGCGCGCCCTCACGGAACGCTCAGCCATCTTCAAGGGCTTT
GTTGAGATGGAGAAGAGCACGCTCTCCGCTCGCTCGCGCAAGCTGTTCACTCTTAGCGCCCTGTATTACG
GCAACCAGTCCCTCCTTCAAGGCCTCGACCTCAAGCAGGACGAGGCGATCAAGCTGACGCAGTCGTTCTG
GGAAGCCGTGGACACGGCGCTGCCGGAGTGGGCGATGGTCCGCGGTAAGCAGCTTTCCGCCCAGGAGATG
CGTCGGGACTTCATCCACAGCCACGGCATCGCCCTGCATGCGCTGGGCCGCGTTGGAAACGCGCTGTTGC
GGGAGTCGGTCAAGGAGGCTGCATGGAAGAGGCGGTTGGTTCCGCTGACGGATGTGGACTGGACCCGGGG
CAACATCGACTGGGAGGGGCGTGCCATCGTCGGCGGCCGCGTTTCCAAAAGCCATCAAAACGTGACATTG
ACCGTTAATTACCTGCGTAAGCATCTGGGCCTGGAGTTGAGCCCGGAAGAGCGGCGCGTGGAAGACGCAT
ATCTGCGAGGCGAGGCATGA