Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismStreptomyces avermitilis MA-4680
GID1029
PID2029
Locus tagSAV_2931
Locations3674850..3676427
Length1578 bp
G+C%62
Link NCBI: gi:162960844  
SequenceATGACCACCATCCCCCTCAACCTCGGGCTTACCCCCGTACGTCGCAAGCCGTTCGGTGGACGCTCCCTGG
AGGAGGTCGTCAACGAACTGACGGAGGAGATCCGGGAGCTCTACACCGCCGACCAGGTGCCCTGGGTCAT
CGGCTACAGCGGGGGTAAGGATTCCACTGCTGTCCTGCAGCTGGTGTGGATGGCTCTCAAGGGCCTGCCT
GCCGAGCAACGCACCAAGGCTGTGCATGTCATTAGCACCGACACGCTTGTGGAGAACCCGGTCGTTGCCG
CCTGGGTGTCCGCCTCGCTGGGCACCATGCAGGATGCGGCGCAGGCGCAGGGTCTGCCGGTCGAGCCGCA
CCGCCTGACTCCGGAGATCAAGGACACCTTTTGGGTGAACTTGCTTGGCCGGGGCTATCCCGCCCCGCGC
CCGAAGTTCCGCTGGTGCACCGAACGTCTGAAGATTAAGCCGTCGAACGCCTTCATCCGCAGTGTGGTCG
CCGCTCACGGCGAGGCGATTATGGTCCTGGGTATCCGTAAAACGGAGAGCCAAGCCCGCGCCCGCGCCAT
GGAAAAGCACGAGAAGCGCCGCGTCCGCGACCGCCTCTCACCCAACGCAAACCTGCCCAACTCCCTCGTC
TACAGCCCCGTTGAGGACTGGACCAACGACGACGTGTGGGAGTTCCTGATGCAAAAGCCCAATCCCTGGG
GCTACACCAATCAGGACCTGCTCACTATGTATCAGGGCGCTTCCAGTGATGGCGAATGCCCGCTCGTGGT
CGACTCCACTACTCCTTCCTGTGGCTCAAGCCGTTTCGGCTGCTGGACCTGCACCCTCGTCGATGAGGAC
AAGTCCATGTCCGCCATGATCCAGAACGACGAGGAAAAGGAGTGGATGACCCCTCTGTTGGAGCTACGTA
ATAAGCTCGACGCCCCATTTGATGAATGGAAAGAGGGCGAGGAAATTCCGGCTGGCCGCAAGGTTGGCGA
TCCTAAGCCTGACAAGCCGGCTCGCGACTTCCGTCGGATGAACGGCAAGGTCATGCTGTTCAAGGACGAC
GCCATCCACGGGCCTTATCTGCAGTCCTTCCGCGAAGAGTGGTTGAAGGACCTGCTGGACGCCCAGACTT
GGATCCGTGCCCATGCTCCGGAGCACGTGCAGAACATCGAGCTGATCACGCTTGAGGAACTGCACGAGAT
CCGCCGGATCTGGGTGTTCGACAAGCACGAGGTCGAAGACAGCCTGCCGCGGATCTACCAGGAGGCCACC
GGCGAGTCCTTCCCGGGTGGCCCGCTCGACGAGCAACTCGTCATGGGGTCCGACGAGATGGACGTCCTCA
AGCAGGTCTGCGATGGCGACGACCTGCATTACAACATGGTCCGCGAGCTCCTCGCCGTTGAGCGGAAGTA
CCGCACCATGGCGCGCCGTTCAGGCCTCTTCCAGGCACTCGAGCAGGCTGTGCAGAAGGGCTACTACGAA
GACCACGAAGACGCCGTGGAATTCGCCACCCGCAAACAGAAGTGGCGAGACGACATCGCCGAGAACCTGA
CCTTCGACGACGAAAACGAACTCGATGCTCCTGCGTAA