Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismStreptomyces avermitilis MA-4680
GID1047
PID2047
Locus tagSAV_2930
Locations3672836..3674863
Length2028 bp
G+C%65
Link NCBI: gi:162960844  
SequenceATGCTCCTGCGTAAGATCACCCTCGAAGAATTCGGGGCGTACCGCGGAAAGCAGTCTCTCGACCTTACCC
CCAAGAAGAACAAGCCGATCATCCTGATCGGCGGGTTGAACGGGTGCGGCAAGACGACTCTGCTCGACGC
CATCCAGCTGGTGCTTTACGGCAACCGGGCGCGCTGCAGCGGTCGTGGCACCAAGGCCTACGAGACGTAC
CTGCGGGAGAGCATCAACCGCAAGGCCGACCCCAGCCGCGGTTCTGCCATCACCCTCGAATTCACCGTCA
TGACCGGTGGGCACGAGCACTACTACCGTCTCGTCCGCAGCTGGCACATCAGCGGTAAGACCCTCAAAGA
GTTCCTCAACGTCTACGTCGACGAGACCTATGGCGAGCGGGTGAAAGCGCAGCGCAGCGCGGAGCCGGAA
GGCAAGTTCAACCGCCTCCTCAGTGAGGGCTGGGCAGACCACGTCGAGTCGCTGCTGCCGTTGGAGATCG
CCTCCCTCGCCTTCTTCGACGGCGAGAAGATTGAGTCGCTGGCCAACCCCGAACGGGCGGCGTCCGTCAT
CGAGTCGGCCGTGCACTCCCTGCTGGGCGTCAGCACCGTCCAGCAGCTGCGCAACGATCTTCTGGCCCTC
CAGCGGCGCCAGAAGCTGTCCGAGGAGGAACAGCATCTCCTGGACAACATCCGTGCCCAGGAAGCCGAAC
GCGAAGCGGTGGTGTCCCAGTACGACATCGCGCACCAGGAACTGGCCCACTCCCGCAGCGAACTCGGCAA
GGCGCAGCGCAAGCTGGACAGCCTGGAGAAGGCGTTCGCTGACGAGGGTGGCGATCTGTTCACCCGGCGC
GTCGAGCTGGAAAACGACAGGAAGCAGGCCCTCGTCCGCCTGGCCCAGGTGCGCACGGAGCTCACGCAAC
TTGCAGCAGGACCCCTGCCGTTGTTGATGGTCGCACCGCTTCTCGACGACGTCCGGCAGCAAGCCAGAAT
CGAGCAGGAAGCCCAGCAGTCCGCCCAGGTCCTCGAGGTCCTCGAAGAGCGCGATCGGTGGCTGCTGGAG
TTGATGCCCGACGCCACCCGAGCCGAGGTCCTCAAGCGGCTGGACGACGACCGCGCCGAGCGCGCCGCCA
AGACGCAGCTGGCGGTGGATCTGCGCCTGCCGCACGACGCGCTGGCCCAGCTCACCGTCCTCGACGAACT
GCTCCAGCGGGATACCCAGCGCTCCGCGCAGCTGCTTCATAGCGCCGCTGAACTGGCCGAGCATCTGGAC
CAGCTGGATCGGCAGCTTGCCGGCGTTCCCGCACAGGACAAGGTCGAAGCCCTCCAGGCGGCCCGGGGCG
AGCAGATCGTAGAGGTAACCCGCTGTGAGACGACTCGCGACCGTGCCACAGCCAAGCTTGAGGACCTCAA
GCGGCGCCGTGAACACGTCACCACGCTGCTGGAGCGTGCGCACAAAGAGTTCGTCCGCACCAAGGTGAAG
GCGGAAGAAGTCGAGCGGGTGATCAAGTACTCGGAGAAGGCCCGCGACACTCTCGAGCGTTTCGGCTCCG
CGCTCCTTGAGCGGCACATCAGTCGGCTCGAAGTGGCCGTTCTGCAGAGCTTCAAGGTCCTCATGCGCAA
GCAGGGTCTCGTGCGCGACCTGCGCATCGATACCGACAAGTTCATCCTCACCCTGGCTGACGCCGATGGC
GAGGCCATCGATCCGGCGCGTCTGAGTGCGGGTGAGCGCCAGCTTCTGGCTGTCTCGCTGCTCTGGGGTT
TGATGCGCGTCGCCGGCAACCGGCTGCCCAGCGTCATCGACACCCCTCTGGGCCGTCTCGACAGCCGTCA
CCGCGAGCACCTCGTCGACCGCTACTTCCCCAACGCCAGCGACCAGGTTCTCCTGCTGTCCACCGACGAG
GAGATCGACGAGTATCTGCTGGGCCGCTTGGAGAAGTCCGTCGCCCACACCTACACGCTCGTCCACGACG
ACACCGAATTCACCACCGCCGTCGTCGAAGGCTACTGGTGGAGTGCAGGAGCCTCGCATGCCGGTTGA