Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismStreptomyces avermitilis MA-4680
GID1065
PID2065
Locus tagSAV_2929
Locations3672466..3672861
Length396 bp
G+C%65
Link NCBI: gi:162960844  
SequenceGTGCAGGAGCCTCGCATGCCGGTTGACCACGTCCGTCTGTCTCAGCCGGCCAAGGATCGGCTGTCCTACC
TCAAGCGCACCACCGGCGTCACTCAGTGGAACGTGCTGTGCCGCTGGGCGCTGCTGCTGTCGCTGAGGGA
CCCTTCCACCCCGCTGGTGAAGGACATCGTCACTGACTCCAACGTTGAGATGAGCTGGAGGACCTTCGCC
GGCCAGTACGGCGACCTCTACCTGGCCCTGCTCAAGCAGCGCTGTGTCGCCATCGGTGAGGAGCCCAATG
ACGAGAACATCCAGCGCGTCCTGACCGTCCACGTGCACCGCGGCATCGGCTACCTCGGTGCCGACAAGCA
GATGGCCACGGTCGAAGGAATGGTCGGCGCCGTCGTGCCCACCTGA