Summary Sequence Alignment 16S rRNA Context  
4 homologues found:

HomologuedndB
OrganismPseudomonas fluorescens PfO-1
GID1012
PID2012
Locus tagPfl_0738
Locations865302..866429
Length1128 bp
G+C%49
Link NCBI: gi:77456228  
SequenceATGCTAAAATCCTCCGGCATGACTAGTCCATTTTCCTACACGTTTCCAGCCATCCGCGGCGTGCAAGCCG
GGCGGGAATTTTACGTCTCCATGTGCCCGTTACGTCTCCTCGCGAAGCTTTTCGTTTTCGACAACGAAGA
GCTTATGCCTGAGCTGCGGGCTCAGAGATCCATCAACCGCACGCGCGTTCCTGAAATTGCTCGCTATATC
CTCTCTAATACTGATAGTTATACGTTTTCGGCAATCACAGCATCTATAGATGGCAAAGTTGGCTTTGAGC
CTGTCGGTACCAACGATACTACTCACTTTCGTATGGGAACGTTGACTGTCGATATGGATGCCAAGTTTGT
CGTGAATGACGGACAGCATCGTCGAGCCGCGATAGAACAGGCACTTGAGGAGCGTCCCGAGTTAGGTGAC
GAAACCATCGCGGTTGTATTTTTTCATGATCGTGGTCTTGAGCGGTGTCAGCAAATGTTTGCGGACCTCA
ATAGACACGCAGTGAAGCCTTCACCTTCCCTTAGTGTTCTTTATGATCATCGTAATGCGGCCGCGAGCGT
AGCTAAGCACCTTGGGCTTACTTCGCGGGTTTTCCGAAACTTGGTCGAATCGGAGCGATCTTCACTTTCC
AAGAGATCTCGCAAGCTTTTCACTCTAAGTGCTTTACACTTTGCCATTCTTGAGATGCTTAGCGCGAAGG
ACCTAGAAGACTTTACCTGGGCTTCGAAGAGATGCAATGAGTTCTGGGAGGTGGTTGGAGAGCAAATACC
CGAATGGACTCATGTACGTGAGAGTCGCATGACTGCGGGAGAGGTGCGGCAAGATTTCATCCATTCACAT
GCGATTGTGCTGCAAGCGCTAGGCCGCGTTGGAAAATTTGTTTATCGAACCGCTGATGGTCGCCCGGATC
TTAAGTCGGCGCTAAAAAATCTACGCGATATCGATTGGTCGCGAACTAATAGTGCTACTTGGGAGGGGCG
CGCCATGATAGGCGGACGGATGGCTAAGAATAGTCAGAATATTACGTTAACATGCAATCAAATAAAATTC
TCGCTTGGTTTGGGTTTGACGCCTGAAGAACAAGTTATAGAAGACGCATTCCTTGCCGCACGTCAGGCCA
CAAGCTAA

HomologuedndC
OrganismPseudomonas fluorescens PfO-1
GID1030
PID2030
Locus tagPfl_0739
Locations866445..867935
Length1491 bp
G+C%47
Link NCBI: gi:77456228  
SequenceATGACCACTCCTCCCGAGGCCATTATTGCAGAAATACAAACCCTCTATAGTTCCGACTCCTTGCCTTGGA
TTGTCGGTTATAGCGGAGGCAAGGACTCGACAGCTTCGTTGCAATTGATTTGGAAGGCCGTTGCAGCGCT
ACCCTCGGAACAGCGCACTAAAGAAATTCACGTAATAAGTACGGATACTCTAGTGGAAAACCCAGTGATC
GCAGCATGGGTTCAGTCGTCGCTGGCGCGCATGAAAGTAGAGGCTGATCGTCAAGGCCTACCAATCCGTC
CCCATCGGTTGACTCCAAGCATTGAACATCGGTTCTGGGTCAATTTGATTGGGAAAGGATATCCTGCCCC
ACGAAATAGGTTTCGTTGGTGCACTGATCGACTAAAAATCAGCGCTTCTACTAAATTTATCCAAGAGCTT
TCGGAGGCCAATAGCGAAGCTATTCTAGTGTTGGGGCAGCGGCGCGGTGAAAGCCAAGCACGTGACAAGG
TCTTAGATCATTATAGTGGAAGCACGCGTGATCGTTTAAGCCGTAACAGCGACCCTAAATTATCGCGTGT
TTGGGTCTATCTGCCTATTGAAACTTGGACGAGTGACGACGTCTGGATGTATGTTCTCACCGATGAGAAC
CCATGGGGTATTGATAACCAAGATTTGTTTGATATTTATAAGGGGGCGACTCCAGACGCCGAGTGCCCAG
TCGTTGTGGATAAGTCGACTCCAAGTTGCGGGGACAGCCGCTTTGGCTGTTATGTCTGCACTATGGTTTC
GCAAGATAAGTCGATGCATGCGATGATTCAGAACGACGACCAGAAATCATGGATGAAACCTATCCTAGAT
TACCGTAATACCTATTTAAGCATCCAAGACTGGGACAAGCGCGACTTTAAACGCATGAATGGTCGGGTAA
AAATTATGGGTAAGGGGGAAACCTCAGAGCTGATTCATGGCCCATACTTACAGAGTTATCGTGCTAAGTT
GCTCGAAGAATTATTGCGTACACAGCTCACTTTACGAAACGCTAAAATACCTGGGCATGATCAGATAGAA
CTGATTTCTATTGAAGAAATTGATGCCATACGCCGTATCTGGGTTGAGGAGAAGGGAGAAATTGAGGATC
TAGTTCCGAAAATCTACGAACGCGTCCTTCAGCAATCCTATCCAGGTCAGGCAATGGAGCAACACCCGCT
TGAGCCTGAAGACCTTGCACTACTTAACGATGTAGCTAATGAGGTCGATTCCGAGGCTGGTGGGCGACTT
TATCAGCTGGCGAGGAATCTGTTGGCGGTACAATATCAGTCCATGCAAAGTCAAAAGCGTTCACATCATT
TAGATAGGTTGGAAGAAGTTCTCAAGGCTAATGCGTTTCGTACCGAAAATGAAGCTTTGGAGTTTGCGAG
AAGCAATCTTGAGGATGGTCAGGAAGAAATAAATGGCGGAGAAGAGCTAGAGCTTATCCCGCTCACAGCG
GTAGAGGCAGAAGAAGACTAA

HomologuedndD
OrganismPseudomonas fluorescens PfO-1
GID1048
PID2048
Locus tagPfl_0740
Locations867938..869920
Length1983 bp
G+C%50
Link NCBI: gi:77456228  
SequenceATGGCAAAGTTATCCATCAATCAGATATCGATTGAGAACCTAGGTCCGTTTCGTGAGCGGCAAAACTTTG
ACCTAAGTGTCATGCCTGGCCGACCTGTCATTTTGCTTAAAGCATTAAATGGCAGTGGAAAAACTACGTT
GCTTACAGCGCTCCAAATAGGACTGTATGGCTATAAAGCGATCAACATAGCGCGCCGTACCGAGTACGAG
CAGCTAATAGCTGGATTGCAGCGGACAGATGCTACTGGGCCAGCTCGAATCGAGATGCATCTGAGTGTTG
AAGTGGGGCACTATATTCAAGAGCTGACCTTACGTCGAGAGTGGCATCCAAAGGAAAAGGGATTCGGAGA
GCAGTTCCGCGTGTTTGCAGGGCACATGGAAGATTTGGCTCTTGCGGAAGACTGGGATGAATTCATTAAT
GGAATTCTGCCGGTAGAGTTAGTGCATCTATTCTTTTTCGATGGTGAAAAGATTGAAGCGTTGGCTAATC
CGGAGCGTTTGCCTGCGCTTCTGCGCCGGGCTACTGAGGTCTTCCTTGGCTTAGGTGGTATTGACGCCTT
GGCAGGAGATCTCAAAGCGGTCGAGCGGCGTGCCAATAAGAAAGTGTTGCCCACCGATTGCGCCGGCAAC
CATAGCCAGACATCTGAATATGAGTTAGAGCTCAAACAGCTTGAACAACGTATTGAAATGCTCTCACAGC
GACAAGCACACGCTAGGACAAACCTCGACGAAGCACAGCGTAAGCTCGAAAGCTTTTCAATCGAAGCGCA
GAGAAGCGGTTTGGATGCCTACCAACAGGCAGCACAGCTACGCGTCCGCCTAGCGCTGTGTGAGCAGGAA
TACGGACGAGCACGCGCTTTGTTAGTAACTGCACTTGAAGACCCGATTTTACCTTTGACCTGGCTCGGGC
CGCTTTGGGAATCCTATAAAGCATATTGGCAGAAGGATCACCAGTCGAAGCACAACGATCTGATCGTCGA
AGAGTTCGCAAAGCGGGACCAGCGTATTCTTGAGCGGCTTGCGCTCGATGCGCCGCATGTTATATCGATA
GCTGCTGAGCTATTCGCCGCTGACCTAAAAGGCTTGCGAGTCGACAAGTCTCATATTCCGATACTGCTTT
CGGGAGGGGATCCTACTGAAATTGAGGCGCAGTTCCAGCAAGCTAAGCGGCGTCTAAGAGACGCAAAGGA
AATCGTTGCCACAGCTCAACGAACAATGGAAAAAGCTCAAGATGCGGTGCATCAGATTCCTGCACATGAG
CAGCTTAGTACCGTATTCGAGGCAATGCAGCAGCACACGCGAGGTGTGTCGGCAGCAGAATTGCAGCTGC
ATGAGTTGAGCCGTGAGCTGGAAGAGGCGCGCAATAAACAGGCTCATTTCGAGCTTCGGTACCAAGCAGC
ATCGGCGCGGGCAAGGGCGGAGCTAAAAGAGAATGCGTTCCATCTTAAAGCTTTGGAGGCCGCTGACCGG
GCAAAAGTTGTCTTAGGCCTGTTCCGCGAGAGGTTGCTGGCATCTAAGGCTCAGTGGTTATCTGAGATGA
TTACCACAGAATTTAAACAGCTATTGCGAAAGCGAAATCTTATTTCTCGAGTATTGGTAGAGGCAGAGAC
CTATGCCGTTTCCATCGAAGATGTTAATGGATATACATTACCCATGGAGCGCCTATCGGCAGGGGAAAGG
CAAATTTTGGCTATTGCTGTGCTTAGCGCGTTGATTCGGGAGCGCAAGGGGCGGTTCCCTGTGATAGTCG
ATACGCCTTTAGCTCGGCTGGATCGCAGTCATCGCGAAGCATTGGTTCACAATTTTTTTGCCAAGATATC
GCATCAGGTAATGGTTCTCTCTACAGACGAAGAGGTCGAGGGTACTGTACATATGGCACTTGAACAACAT
ATGAGTCGTGAGTATTCATTGATGTTCGATGATGAAAGTCGCCGTAGCGTCGTTAGTATAAATACTCAAC
AGTTCCAGTTAGATACCCTATGA

HomologuedndE
OrganismPseudomonas fluorescens PfO-1
GID1066
PID2066
Locus tagPfl_0741
Locations869917..870276
Length360 bp
G+C%42
Link NCBI: gi:77456228  
SequenceATGATTATTGATCGAATTCGCTTAACTGCCGCCGCGAAGGTACAGCTATCAACGCTGAAACGGCGCTATG
GTCTAGAGCATAATAATACTATTTGTAGATATGCGCTCTGTATGTCTCTTGCTACTCCAGGAGAGTTGAT
CCAAGAAGAATTGTCATTCCTGGGTGGACTTGAAATTGACTGGAAAACGTTCACGACTGGAAATGAAGAC
TTTTATATTAATCTAGTAAAAGCTTGGTCCGAAAACAATGCTCAGCATGTTGATGATGAGAGTATTAAGA
GATATATAACTCTACATGTCCACAGAGGGCTTTCATTTCTGTCTGGGCGATCTGAGCGCCTCGAATTCAT
GCTCGAGTAG