Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismPseudomonas fluorescens PfO-1
GID1012
PID2012
Locus tagPfl_0738
Locations865302..866429
Length1128 bp
G+C%49
Link NCBI: gi:77456228  
SequenceATGCTAAAATCCTCCGGCATGACTAGTCCATTTTCCTACACGTTTCCAGCCATCCGCGGCGTGCAAGCCG
GGCGGGAATTTTACGTCTCCATGTGCCCGTTACGTCTCCTCGCGAAGCTTTTCGTTTTCGACAACGAAGA
GCTTATGCCTGAGCTGCGGGCTCAGAGATCCATCAACCGCACGCGCGTTCCTGAAATTGCTCGCTATATC
CTCTCTAATACTGATAGTTATACGTTTTCGGCAATCACAGCATCTATAGATGGCAAAGTTGGCTTTGAGC
CTGTCGGTACCAACGATACTACTCACTTTCGTATGGGAACGTTGACTGTCGATATGGATGCCAAGTTTGT
CGTGAATGACGGACAGCATCGTCGAGCCGCGATAGAACAGGCACTTGAGGAGCGTCCCGAGTTAGGTGAC
GAAACCATCGCGGTTGTATTTTTTCATGATCGTGGTCTTGAGCGGTGTCAGCAAATGTTTGCGGACCTCA
ATAGACACGCAGTGAAGCCTTCACCTTCCCTTAGTGTTCTTTATGATCATCGTAATGCGGCCGCGAGCGT
AGCTAAGCACCTTGGGCTTACTTCGCGGGTTTTCCGAAACTTGGTCGAATCGGAGCGATCTTCACTTTCC
AAGAGATCTCGCAAGCTTTTCACTCTAAGTGCTTTACACTTTGCCATTCTTGAGATGCTTAGCGCGAAGG
ACCTAGAAGACTTTACCTGGGCTTCGAAGAGATGCAATGAGTTCTGGGAGGTGGTTGGAGAGCAAATACC
CGAATGGACTCATGTACGTGAGAGTCGCATGACTGCGGGAGAGGTGCGGCAAGATTTCATCCATTCACAT
GCGATTGTGCTGCAAGCGCTAGGCCGCGTTGGAAAATTTGTTTATCGAACCGCTGATGGTCGCCCGGATC
TTAAGTCGGCGCTAAAAAATCTACGCGATATCGATTGGTCGCGAACTAATAGTGCTACTTGGGAGGGGCG
CGCCATGATAGGCGGACGGATGGCTAAGAATAGTCAGAATATTACGTTAACATGCAATCAAATAAAATTC
TCGCTTGGTTTGGGTTTGACGCCTGAAGAACAAGTTATAGAAGACGCATTCCTTGCCGCACGTCAGGCCA
CAAGCTAA