Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismPseudomonas fluorescens PfO-1
GID1030
PID2030
Locus tagPfl_0739
Locations866445..867935
Length1491 bp
G+C%47
Link NCBI: gi:77456228  
SequenceATGACCACTCCTCCCGAGGCCATTATTGCAGAAATACAAACCCTCTATAGTTCCGACTCCTTGCCTTGGA
TTGTCGGTTATAGCGGAGGCAAGGACTCGACAGCTTCGTTGCAATTGATTTGGAAGGCCGTTGCAGCGCT
ACCCTCGGAACAGCGCACTAAAGAAATTCACGTAATAAGTACGGATACTCTAGTGGAAAACCCAGTGATC
GCAGCATGGGTTCAGTCGTCGCTGGCGCGCATGAAAGTAGAGGCTGATCGTCAAGGCCTACCAATCCGTC
CCCATCGGTTGACTCCAAGCATTGAACATCGGTTCTGGGTCAATTTGATTGGGAAAGGATATCCTGCCCC
ACGAAATAGGTTTCGTTGGTGCACTGATCGACTAAAAATCAGCGCTTCTACTAAATTTATCCAAGAGCTT
TCGGAGGCCAATAGCGAAGCTATTCTAGTGTTGGGGCAGCGGCGCGGTGAAAGCCAAGCACGTGACAAGG
TCTTAGATCATTATAGTGGAAGCACGCGTGATCGTTTAAGCCGTAACAGCGACCCTAAATTATCGCGTGT
TTGGGTCTATCTGCCTATTGAAACTTGGACGAGTGACGACGTCTGGATGTATGTTCTCACCGATGAGAAC
CCATGGGGTATTGATAACCAAGATTTGTTTGATATTTATAAGGGGGCGACTCCAGACGCCGAGTGCCCAG
TCGTTGTGGATAAGTCGACTCCAAGTTGCGGGGACAGCCGCTTTGGCTGTTATGTCTGCACTATGGTTTC
GCAAGATAAGTCGATGCATGCGATGATTCAGAACGACGACCAGAAATCATGGATGAAACCTATCCTAGAT
TACCGTAATACCTATTTAAGCATCCAAGACTGGGACAAGCGCGACTTTAAACGCATGAATGGTCGGGTAA
AAATTATGGGTAAGGGGGAAACCTCAGAGCTGATTCATGGCCCATACTTACAGAGTTATCGTGCTAAGTT
GCTCGAAGAATTATTGCGTACACAGCTCACTTTACGAAACGCTAAAATACCTGGGCATGATCAGATAGAA
CTGATTTCTATTGAAGAAATTGATGCCATACGCCGTATCTGGGTTGAGGAGAAGGGAGAAATTGAGGATC
TAGTTCCGAAAATCTACGAACGCGTCCTTCAGCAATCCTATCCAGGTCAGGCAATGGAGCAACACCCGCT
TGAGCCTGAAGACCTTGCACTACTTAACGATGTAGCTAATGAGGTCGATTCCGAGGCTGGTGGGCGACTT
TATCAGCTGGCGAGGAATCTGTTGGCGGTACAATATCAGTCCATGCAAAGTCAAAAGCGTTCACATCATT
TAGATAGGTTGGAAGAAGTTCTCAAGGCTAATGCGTTTCGTACCGAAAATGAAGCTTTGGAGTTTGCGAG
AAGCAATCTTGAGGATGGTCAGGAAGAAATAAATGGCGGAGAAGAGCTAGAGCTTATCCCGCTCACAGCG
GTAGAGGCAGAAGAAGACTAA