Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismPseudomonas fluorescens PfO-1
GID1048
PID2048
Locus tagPfl_0740
Locations867938..869920
Length1983 bp
G+C%50
Link NCBI: gi:77456228  
SequenceATGGCAAAGTTATCCATCAATCAGATATCGATTGAGAACCTAGGTCCGTTTCGTGAGCGGCAAAACTTTG
ACCTAAGTGTCATGCCTGGCCGACCTGTCATTTTGCTTAAAGCATTAAATGGCAGTGGAAAAACTACGTT
GCTTACAGCGCTCCAAATAGGACTGTATGGCTATAAAGCGATCAACATAGCGCGCCGTACCGAGTACGAG
CAGCTAATAGCTGGATTGCAGCGGACAGATGCTACTGGGCCAGCTCGAATCGAGATGCATCTGAGTGTTG
AAGTGGGGCACTATATTCAAGAGCTGACCTTACGTCGAGAGTGGCATCCAAAGGAAAAGGGATTCGGAGA
GCAGTTCCGCGTGTTTGCAGGGCACATGGAAGATTTGGCTCTTGCGGAAGACTGGGATGAATTCATTAAT
GGAATTCTGCCGGTAGAGTTAGTGCATCTATTCTTTTTCGATGGTGAAAAGATTGAAGCGTTGGCTAATC
CGGAGCGTTTGCCTGCGCTTCTGCGCCGGGCTACTGAGGTCTTCCTTGGCTTAGGTGGTATTGACGCCTT
GGCAGGAGATCTCAAAGCGGTCGAGCGGCGTGCCAATAAGAAAGTGTTGCCCACCGATTGCGCCGGCAAC
CATAGCCAGACATCTGAATATGAGTTAGAGCTCAAACAGCTTGAACAACGTATTGAAATGCTCTCACAGC
GACAAGCACACGCTAGGACAAACCTCGACGAAGCACAGCGTAAGCTCGAAAGCTTTTCAATCGAAGCGCA
GAGAAGCGGTTTGGATGCCTACCAACAGGCAGCACAGCTACGCGTCCGCCTAGCGCTGTGTGAGCAGGAA
TACGGACGAGCACGCGCTTTGTTAGTAACTGCACTTGAAGACCCGATTTTACCTTTGACCTGGCTCGGGC
CGCTTTGGGAATCCTATAAAGCATATTGGCAGAAGGATCACCAGTCGAAGCACAACGATCTGATCGTCGA
AGAGTTCGCAAAGCGGGACCAGCGTATTCTTGAGCGGCTTGCGCTCGATGCGCCGCATGTTATATCGATA
GCTGCTGAGCTATTCGCCGCTGACCTAAAAGGCTTGCGAGTCGACAAGTCTCATATTCCGATACTGCTTT
CGGGAGGGGATCCTACTGAAATTGAGGCGCAGTTCCAGCAAGCTAAGCGGCGTCTAAGAGACGCAAAGGA
AATCGTTGCCACAGCTCAACGAACAATGGAAAAAGCTCAAGATGCGGTGCATCAGATTCCTGCACATGAG
CAGCTTAGTACCGTATTCGAGGCAATGCAGCAGCACACGCGAGGTGTGTCGGCAGCAGAATTGCAGCTGC
ATGAGTTGAGCCGTGAGCTGGAAGAGGCGCGCAATAAACAGGCTCATTTCGAGCTTCGGTACCAAGCAGC
ATCGGCGCGGGCAAGGGCGGAGCTAAAAGAGAATGCGTTCCATCTTAAAGCTTTGGAGGCCGCTGACCGG
GCAAAAGTTGTCTTAGGCCTGTTCCGCGAGAGGTTGCTGGCATCTAAGGCTCAGTGGTTATCTGAGATGA
TTACCACAGAATTTAAACAGCTATTGCGAAAGCGAAATCTTATTTCTCGAGTATTGGTAGAGGCAGAGAC
CTATGCCGTTTCCATCGAAGATGTTAATGGATATACATTACCCATGGAGCGCCTATCGGCAGGGGAAAGG
CAAATTTTGGCTATTGCTGTGCTTAGCGCGTTGATTCGGGAGCGCAAGGGGCGGTTCCCTGTGATAGTCG
ATACGCCTTTAGCTCGGCTGGATCGCAGTCATCGCGAAGCATTGGTTCACAATTTTTTTGCCAAGATATC
GCATCAGGTAATGGTTCTCTCTACAGACGAAGAGGTCGAGGGTACTGTACATATGGCACTTGAACAACAT
ATGAGTCGTGAGTATTCATTGATGTTCGATGATGAAAGTCGCCGTAGCGTCGTTAGTATAAATACTCAAC
AGTTCCAGTTAGATACCCTATGA