Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismPseudomonas fluorescens PfO-1
GID1066
PID2066
Locus tagPfl_0741
Locations869917..870276
Length360 bp
G+C%42
Link NCBI: gi:77456228  
SequenceATGATTATTGATCGAATTCGCTTAACTGCCGCCGCGAAGGTACAGCTATCAACGCTGAAACGGCGCTATG
GTCTAGAGCATAATAATACTATTTGTAGATATGCGCTCTGTATGTCTCTTGCTACTCCAGGAGAGTTGAT
CCAAGAAGAATTGTCATTCCTGGGTGGACTTGAAATTGACTGGAAAACGTTCACGACTGGAAATGAAGAC
TTTTATATTAATCTAGTAAAAGCTTGGTCCGAAAACAATGCTCAGCATGTTGATGATGAGAGTATTAAGA
GATATATAACTCTACATGTCCACAGAGGGCTTTCATTTCTGTCTGGGCGATCTGAGCGCCTCGAATTCAT
GCTCGAGTAG