Summary Sequence Alignment 16S rRNA Context  
5 homologues found:

HomologuedndA
OrganismPseudoalteromonas haloplanktis TAC125
GID1003
PID2003
Locus tagPSHAb0099
Locations117905..119032
Length1128 bp
G+C%38
Link NCBI: gi:77361923  
SequenceATGACAACTTATTTAGATATGAATGCCACGGCACCAGTGCTTAAAGAGGTTGCTGATTTAGTTAGAAAAA
TGTTTTTAGATGAGTACGGAAATGCTGGTAGTCGTACTCATGAGTTTGGTACTAATGCTAAAAAATCTGT
TGAAAAAGCACGTAAGCAAGTAGCTGAAGTTGTGGATGCTGATAAGTCGGAAGTTATTTTTACTAGTGGT
GCAACCGAGAGTAATAACATTGCGATTCTTGGGTTACGTGAATTTGGTGAACAAGAATCTAAAAAGCATA
TAATTACTACTCGAATTGAACATAAAGCTGTATTGGAGCCTATAGAGTATTTATTTAAAAATGGCTTTGA
AGTTAGCTTCTTAGAAGTTGATGAGAGTGGTGTTGTTGACTCCGCTGAACTTAAAAATTTATTGCGAAAA
GATACGCTACTTGTTTCGATTATGCATGTGAATAACGAAACAGGTTCTATACAGCCTATTATTGATATTT
GCGATGTACTTGAATTGCACGAAGCATTTTTACATATCGATGCGGCTCAAAGTTTTGGCAAATTGAGTGA
CGATTTAAAATGTAAGCGTATTGATTTAATTAGTGTAAGTGGGCACAAAGTTTATGCTCCTAAGGGGGTT
GGTGCATTAGTTATGCGTAAGCGTGGTTTTATGAAACCACCTTTGAAGCCAATTATGTTTGGTGGTGGGC
AAGAAAAAGGGCTACGGCCTGGTACTTTAGCAGTTCCATTAATAGCGGGTTTTGGCTTAGCGTGTGAAAT
AGCACAAAAAAATTCTACGGCATGGCAAAAGCATGCACAAAGTTTAAAAGATGATTTGATCGCAGCTTTA
AATACACTCGATGCACAATACAACGGTGAGAATACATCTCCCTTTGTGCTTAACTTTTCTGTTCCAGGTA
TTAACTCTGAGGCGGCTATGGTTATGTTAAAAGGGATCGCAGCTGTATCTAATGGCTCTGCGTGTACATC
ATCAAGTTACACTCCTTCCCATGTTTTAACTGCAATGCAATTAGATGAAAAACGTATTGCCGGTGCAATT
AGAGTTTCATGGGGGCACATGACAGAATCATTACCTATCACTGAAATAATCGAAAAGTTGGAACAGTTAA
AGTTATGA

HomologuedndB
OrganismPseudoalteromonas haloplanktis TAC125
GID1013
PID2013
Locus tagPSHAb0098
Locations116678..117769
Length1092 bp
G+C%35
Link NCBI: gi:77361923  
SequenceATGAACCAAATTGTGTCAGGAACTTCATTCCCTGCAATTAAAGGAATGCAAGCAAAAACAGAATATTACA
TTGTAATGTGCCCACTAAAAAGACTTAGTAAAATATTTACTTTAGATGAGGGACAATTACCTGTAAATCA
GCGTGCTCAACGAATAATAAACGAAGAGCGCATTCCTGATATCGCAAATTATATTTTAGACAGTAGAGAC
AACTATGTTTTTTCAGCGCTTACGGCGTGTATCGACGGTTTAAGTGAATTTATTGGTATTGGCGAGTCGA
AGCATGAACAAAAAATTGGAACTCTAGTTATTGATGAAGATGCTGAAATTTATATTACCGATGGTCAACA
TCGTAATGCTGCAATTTTAGAGGCTTTAAAAGCAGATCCAACTCTTGCTGATGAAACTATTTCAGTCGTA
TTTTTTACAAATAAATCACTAGAAGAACGCCAGCGTATTTTTAAAGATCTAAACCTATACCCAGTAAAAA
CAGATAGCTCTTTAAGTATTACTTACGACGATAAACCAGATGCAATTCTGTCTAAAACTATAATATTTAG
AAGTGAGCAATTCACGAAACTTGTTCATATGGAAAAAAGTAATTTAGGTCCTCGCTCTAAGAAACTAATA
AGCCATAGCGCAGTAAATAAAGCTAGCAAGTACTTACTAGGTACAATAACAAAAAATAACTATGAGTCTT
TAATTCCAGTGGCTTTTGAGTTTTGGCACGAAGTACTTAAAAACATGCCTGCTTGGCAATTAGTATGTGA
CGATAAAGCATCTGGCGGTGAGTTACGTGACGAATCAATTCACGCACATGCAGTAACATTTCATGCCCTT
GGTTTATTAGGATTTCACCTACTGAATAACGACCCAAAATGGCAAAGTAAACTAAAAGGGCTTCAAAAAA
TAAATTGGAGCCGTAACAGCATAAATTGGTCTGGCCGCTGCGTTATAAATAACTCCATGACAAATAATCG
AAAAGCAGCTGAGCTAACCTGTATACAAATCAAATCGCATTTAAACATTCCACTTACCGATAAAGAACAA
TTGGTAGAAAAAACATTTAAAGAGGCACGAAATGGCTACTGA

HomologuedndC
OrganismPseudoalteromonas haloplanktis TAC125
GID1031
PID2031
Locus tagPSHAb0097
Locations115021..116688
Length1668 bp
G+C%39
Link NCBI: gi:77361923  
SequenceATGGCTACTGATAGCGTAGTACAGTTCCATTCTGCATTTAACCAAGATGGATTAAAAAACACTATAGAGC
AAAGCATTAAACATATAAAAATGCTTTATCAAAGTGACTCAATTCCATGGGTAATTGGCTACAGTGGCGG
CAAAGATTCAACTGCTATACTGCAGTTGATTTGGTATGCCCTACAAGAGCTAGCTCAAGAAGGTAAATGC
GAGAAAAAAGTACATGTAATAAGCACCGATACCCTAGTAGAAAACCCAATTGTTGCTATGTGGGTAGGAA
AGTCGCTAGAGCGAATGAAAGAACAAGCCGATGCACAAGGCTTGCCTATAGTTCCTCACCGCCTTACACC
TGCGGTAAAAGACCGTTTTTGGGTTAACTTAATCGGTAAGGGTTACCCTGCTCCTCGTTATAAATTTAGA
TGGTGTACAGACCGCCTAAAAATATCGCCATCAAATACATTTATCCAAAACATGGCTGATAAAAATGGCG
AAGCCATTTTAGTACTTGGTACGCGTAAAGCCGAAAGTACAGCACGTGCTGCAAGTATGGAACGCTTCGA
AAGCTCGACCACCAATACACGAAAAGCGCTTGGCTTGACCGAAAACGGTTCACTTGAGCGAGTTTGGGTT
TATACACCAATTGCTAGCTGGAGTAACGATGATGTGTGGGTATACTTAAATAGTGTAGATAACCCATGGA
ATTTCCCAAATCACGATTTAATGGGCATGTATCAGGGTGCAACTGAAGGCGGTGAATGCCCGCTTGTAGT
GGATAAATCGACGCAAAGCTGTGGTGATAGCCGTTTTGGTTGCTACGTTTGTACAATGGTATCTGAAGAT
AAATCAATGAATGCCATGATTGCCAACGATGATGAAAAAGAGTGGATGTATCCACTTGTAGCGCTTCGTA
ATGAAATTGAAGTTAACGACTCTAACCGCGCTAAAAAAATTGAAAAACTAACACGAGATAAAGCTAATCG
CGACTTCAGACGTATGAATGGCAATTTAACTGTGCATATATCTAAACATGGCGCCGATTTAGTACCAGGC
CCTTACATACAAAAATTTAGAGAACACTTACTTGGCAAAGTTTTAGAAGCACAGCTAGCAGTGCAACAAC
TTGGGCCTGATGAAGTAAAAAATTTAGAGCTTTTACCATTAGAAGATCTTGAAGAAATACGCCGAATTTG
GCTTGAAGAAAAGCACGAAGCTGAAGATAGCGTGCCTAAAATTTACCAAAATGTATTCAAAAAGCCTTAT
CCAGGTAAGCAACGCGCACACCATCCTATTCTTAATTTAGACGTACTTAATAAATTAAAAGCGCATTGCC
AAGAGCAAGGTGACGAAGATGGTTTGTTATATCAACAAATGCGTGCCGTTATGAGTATTGCTAATAAACA
TAAAAACCAACTGCGTAGAGCAAAACTATCCGATGAGCTTACACAAAGCTTAGATAAAGGCGCATTTAAC
AATTTATTTGAAGCAAAACAGTTTGCACTTGAACGTGAACGTAACCGCTTGCAAATACAACTGAGCAATT
CTCCTAATTTAACTGAAGATGATAAAGCTGCCATTCAAGAAAAAATCATCATGGTAACTAAATCGATTAA
AGAACAAGGCTACAGCTCTCTATTAATCGATTTTGAAGAGGTACAAGATGATAATTAA

HomologuedndD
OrganismPseudoalteromonas haloplanktis TAC125
GID1049
PID2049
Locus tagPSHAb0096
Locations113073..115031
Length1959 bp
G+C%37
Link NCBI: gi:77361923  
SequenceATGATAATTAAACAGCTCACCCTTGAAAATTTTGGTATTTATCAGGGTCGTCACGAAGTCAATTTAAGTA
CATCAGCAAATAAACCAATTATTCTTTTTGGTGGCTTAAATGGCGGTGGTAAAACAACCTTTTTAGATGC
GTTGCAACTTGTGCTTTACGGTAAGCATGCCAAATGCTCTAACCGAGGTCATCAGTCATATGGTAATTAT
TTAATAAGTACCAAAAATCGTTATGTGGGTAACGACGATACAGTTGAAATTTCACTAACGTTTACTCACA
CAACTGATACAACAACTAACGAGTTTGTTATTGTTCGAAGTTGGAAAACAAATACAAAAGACGTAAAAGA
TAAAGTTGTAGTTTATTGTAATCAACAAGAAGATTCTCATTTGAGCCAATACTGGGATGAGTTTGTAAAC
GAATTTATTCCACTTAGCTTATCTGATTTATTCTTTTTTGATGGCGAAAAAATAGAAAATTTAGCACACC
CAGACAGAAGTGCTGATTTAATTAAAACGGGTATAGAAAATCTACTTGGGCTTGACCTACTATCTCAGCT
GCAAATTGATTTAAATAATGTAGAGCGTAAACGTAAAAGTGAAAACCTAGATACAACCGTAGTAGCCAAA
GTAGAAGCTCTTGAAGCAGAAATAACTGAGCAAACAACTATTGTAACAGGTTTTAAAACTGATATTGCTA
ACTTAGAAAAACGTGCCAGTGATACTAACTTGAGTATTAATAAAGCCCGACAAAAAGTAAGAAGTGCAGG
CGCTCATTTAATTGAAGAGCGCGACATTATAAAGTTTGAACTCGGCGCAATTGAAGAAAAACTTAAAGCA
AATTTAGCCGAACGTGTAAAGCTAGATGCCGGATGCGGACCACTTGGTTTAATACCCAATTTAATATCAA
GCACAAAAGCCCAAATTAAAAAGGAAGAACAGGCAGTACAAGCGAACGTTATTCAAAGTGCTATTACAGA
GTACGAAGCCACAATTACGCAAACGCTAGTTAATGAAAACGTACCAGAAACCGCGCTTAGCGCACTCAGT
AATAAAATGGCTACCCTTGCCAAAGAACGCGAAGAACTAGCAAGCACAGAGTGTTATATTGCTAGTAACA
TCGCTATTTTTAATGGTCTTGATGAAAAAATAGCAAACGATAAGTTAGAGCGTTCAAACTTACTAAAAGC
TCGCGTAGAATTGTTTGAACAACAAGCGCTATTTAATAAAAAGCTTGAATCAATACCTGATTACGAAACT
GTTCAGCATTTACTTAGCGAACTAGCCGGGCTTGAAGTCGAGCTAAAAAACAGCTTTGTTTTAATAAAAC
AAAAACAGCAGTTGTTACAGCAAGCGCAAGCACGTGACGAAGTATTAAATACACGCTACGCAAACTTATT
AACCCAACAAAGCAAAGACACGTTTGAACAAAAACGCTCAATCCAAGTCGCGGATCATATTGGTAAGCTT
AAAAATACTATGAAGTCATTTGCCGATGAGCTAATACGTGAAAATGTAACAGGGCTTGAAGAGCACATTG
CCGCTAAGTTTTTTGACCTCTCTCGTAAAAACAACTTAATTACCGGTGTTAAAATTTGCCCTGATTCATT
CAAACTTACGTTACTCGATAACAATAAAAACCCAATGTCACCAAGCCGCTTATCGGCCGGTGAAAGGCAG
TTACTTGCTATAGCAATTTTATGGGGCTTAGCTGAAGCATCAGGCAAAGAAATCCCAACCGTTATCGATA
CACCACTTGGTCGCTTAGATGGAAAACATCGTAGTAAGCTTATTAATAACTACTTTCCTAAAGCATCAAG
CCAAGTGATTTTACTATCGACTGACGAAGAAATAACAGGGCAGTATTACACGCAATTAAAACCTGCAATT
TGCCGTGAATACCACATTAGTTACAACGAGCACGAACAAACCTCAACCTTTACTGAGGGGTACTTTTAA

HomologuedndE
OrganismPseudoalteromonas haloplanktis TAC125
GID1067
PID2067
Locus tagPSHAb0095
Locations112702..113073
Length372 bp
G+C%41
Link NCBI: gi:77361923  
SequenceATGAATACCACACTCCAAACAATTGACTCAATTAAGCTCTCTGAAAAACAAAAGCAGCAACTCGTTCGCC
TTAAAAGTAAAACAGGCATCGAAAATTGGAACGTACTGTGCCGCTGGGCTCTGTGTATGTCGCTCGCTGA
AGATTCAATACCACCTGTTGAGGAAATCCCATCAGACAGTAACGTAGAAATGAGCTGGAAGGTATTTGCT
GGTGAATATGCCGATGTATATTTAGCAGTGCTGCGTGAAGCGTATCAAAAACAAAGTGCACACCTAGAAG
GTGTGCATTTTGGAGATTTTCTTAAGCTGCACTTGAATCGAGGGATTAGTTTCTCACTAAGTTTTCCCAG
TTATAAATGTAAAGGATTATAA