Summary Sequence Context  
1 homologue found:

HomologuedndA
OrganismPseudoalteromonas haloplanktis TAC125
GID1003
PID2003
Locus tagPSHAb0099
Locations117905..119032
Length1128 bp
G+C%38
Link NCBI: gi:77361923  
SequenceATGACAACTTATTTAGATATGAATGCCACGGCACCAGTGCTTAAAGAGGTTGCTGATTTAGTTAGAAAAA
TGTTTTTAGATGAGTACGGAAATGCTGGTAGTCGTACTCATGAGTTTGGTACTAATGCTAAAAAATCTGT
TGAAAAAGCACGTAAGCAAGTAGCTGAAGTTGTGGATGCTGATAAGTCGGAAGTTATTTTTACTAGTGGT
GCAACCGAGAGTAATAACATTGCGATTCTTGGGTTACGTGAATTTGGTGAACAAGAATCTAAAAAGCATA
TAATTACTACTCGAATTGAACATAAAGCTGTATTGGAGCCTATAGAGTATTTATTTAAAAATGGCTTTGA
AGTTAGCTTCTTAGAAGTTGATGAGAGTGGTGTTGTTGACTCCGCTGAACTTAAAAATTTATTGCGAAAA
GATACGCTACTTGTTTCGATTATGCATGTGAATAACGAAACAGGTTCTATACAGCCTATTATTGATATTT
GCGATGTACTTGAATTGCACGAAGCATTTTTACATATCGATGCGGCTCAAAGTTTTGGCAAATTGAGTGA
CGATTTAAAATGTAAGCGTATTGATTTAATTAGTGTAAGTGGGCACAAAGTTTATGCTCCTAAGGGGGTT
GGTGCATTAGTTATGCGTAAGCGTGGTTTTATGAAACCACCTTTGAAGCCAATTATGTTTGGTGGTGGGC
AAGAAAAAGGGCTACGGCCTGGTACTTTAGCAGTTCCATTAATAGCGGGTTTTGGCTTAGCGTGTGAAAT
AGCACAAAAAAATTCTACGGCATGGCAAAAGCATGCACAAAGTTTAAAAGATGATTTGATCGCAGCTTTA
AATACACTCGATGCACAATACAACGGTGAGAATACATCTCCCTTTGTGCTTAACTTTTCTGTTCCAGGTA
TTAACTCTGAGGCGGCTATGGTTATGTTAAAAGGGATCGCAGCTGTATCTAATGGCTCTGCGTGTACATC
ATCAAGTTACACTCCTTCCCATGTTTTAACTGCAATGCAATTAGATGAAAAACGTATTGCCGGTGCAATT
AGAGTTTCATGGGGGCACATGACAGAATCATTACCTATCACTGAAATAATCGAAAAGTTGGAACAGTTAA
AGTTATGA