Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismPseudoalteromonas haloplanktis TAC125
GID1013
PID2013
Locus tagPSHAb0098
Locations116678..117769
Length1092 bp
G+C%35
Link NCBI: gi:77361923  
SequenceATGAACCAAATTGTGTCAGGAACTTCATTCCCTGCAATTAAAGGAATGCAAGCAAAAACAGAATATTACA
TTGTAATGTGCCCACTAAAAAGACTTAGTAAAATATTTACTTTAGATGAGGGACAATTACCTGTAAATCA
GCGTGCTCAACGAATAATAAACGAAGAGCGCATTCCTGATATCGCAAATTATATTTTAGACAGTAGAGAC
AACTATGTTTTTTCAGCGCTTACGGCGTGTATCGACGGTTTAAGTGAATTTATTGGTATTGGCGAGTCGA
AGCATGAACAAAAAATTGGAACTCTAGTTATTGATGAAGATGCTGAAATTTATATTACCGATGGTCAACA
TCGTAATGCTGCAATTTTAGAGGCTTTAAAAGCAGATCCAACTCTTGCTGATGAAACTATTTCAGTCGTA
TTTTTTACAAATAAATCACTAGAAGAACGCCAGCGTATTTTTAAAGATCTAAACCTATACCCAGTAAAAA
CAGATAGCTCTTTAAGTATTACTTACGACGATAAACCAGATGCAATTCTGTCTAAAACTATAATATTTAG
AAGTGAGCAATTCACGAAACTTGTTCATATGGAAAAAAGTAATTTAGGTCCTCGCTCTAAGAAACTAATA
AGCCATAGCGCAGTAAATAAAGCTAGCAAGTACTTACTAGGTACAATAACAAAAAATAACTATGAGTCTT
TAATTCCAGTGGCTTTTGAGTTTTGGCACGAAGTACTTAAAAACATGCCTGCTTGGCAATTAGTATGTGA
CGATAAAGCATCTGGCGGTGAGTTACGTGACGAATCAATTCACGCACATGCAGTAACATTTCATGCCCTT
GGTTTATTAGGATTTCACCTACTGAATAACGACCCAAAATGGCAAAGTAAACTAAAAGGGCTTCAAAAAA
TAAATTGGAGCCGTAACAGCATAAATTGGTCTGGCCGCTGCGTTATAAATAACTCCATGACAAATAATCG
AAAAGCAGCTGAGCTAACCTGTATACAAATCAAATCGCATTTAAACATTCCACTTACCGATAAAGAACAA
TTGGTAGAAAAAACATTTAAAGAGGCACGAAATGGCTACTGA