Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismPseudoalteromonas haloplanktis TAC125
GID1031
PID2031
Locus tagPSHAb0097
Locations115021..116688
Length1668 bp
G+C%39
Link NCBI: gi:77361923  
SequenceATGGCTACTGATAGCGTAGTACAGTTCCATTCTGCATTTAACCAAGATGGATTAAAAAACACTATAGAGC
AAAGCATTAAACATATAAAAATGCTTTATCAAAGTGACTCAATTCCATGGGTAATTGGCTACAGTGGCGG
CAAAGATTCAACTGCTATACTGCAGTTGATTTGGTATGCCCTACAAGAGCTAGCTCAAGAAGGTAAATGC
GAGAAAAAAGTACATGTAATAAGCACCGATACCCTAGTAGAAAACCCAATTGTTGCTATGTGGGTAGGAA
AGTCGCTAGAGCGAATGAAAGAACAAGCCGATGCACAAGGCTTGCCTATAGTTCCTCACCGCCTTACACC
TGCGGTAAAAGACCGTTTTTGGGTTAACTTAATCGGTAAGGGTTACCCTGCTCCTCGTTATAAATTTAGA
TGGTGTACAGACCGCCTAAAAATATCGCCATCAAATACATTTATCCAAAACATGGCTGATAAAAATGGCG
AAGCCATTTTAGTACTTGGTACGCGTAAAGCCGAAAGTACAGCACGTGCTGCAAGTATGGAACGCTTCGA
AAGCTCGACCACCAATACACGAAAAGCGCTTGGCTTGACCGAAAACGGTTCACTTGAGCGAGTTTGGGTT
TATACACCAATTGCTAGCTGGAGTAACGATGATGTGTGGGTATACTTAAATAGTGTAGATAACCCATGGA
ATTTCCCAAATCACGATTTAATGGGCATGTATCAGGGTGCAACTGAAGGCGGTGAATGCCCGCTTGTAGT
GGATAAATCGACGCAAAGCTGTGGTGATAGCCGTTTTGGTTGCTACGTTTGTACAATGGTATCTGAAGAT
AAATCAATGAATGCCATGATTGCCAACGATGATGAAAAAGAGTGGATGTATCCACTTGTAGCGCTTCGTA
ATGAAATTGAAGTTAACGACTCTAACCGCGCTAAAAAAATTGAAAAACTAACACGAGATAAAGCTAATCG
CGACTTCAGACGTATGAATGGCAATTTAACTGTGCATATATCTAAACATGGCGCCGATTTAGTACCAGGC
CCTTACATACAAAAATTTAGAGAACACTTACTTGGCAAAGTTTTAGAAGCACAGCTAGCAGTGCAACAAC
TTGGGCCTGATGAAGTAAAAAATTTAGAGCTTTTACCATTAGAAGATCTTGAAGAAATACGCCGAATTTG
GCTTGAAGAAAAGCACGAAGCTGAAGATAGCGTGCCTAAAATTTACCAAAATGTATTCAAAAAGCCTTAT
CCAGGTAAGCAACGCGCACACCATCCTATTCTTAATTTAGACGTACTTAATAAATTAAAAGCGCATTGCC
AAGAGCAAGGTGACGAAGATGGTTTGTTATATCAACAAATGCGTGCCGTTATGAGTATTGCTAATAAACA
TAAAAACCAACTGCGTAGAGCAAAACTATCCGATGAGCTTACACAAAGCTTAGATAAAGGCGCATTTAAC
AATTTATTTGAAGCAAAACAGTTTGCACTTGAACGTGAACGTAACCGCTTGCAAATACAACTGAGCAATT
CTCCTAATTTAACTGAAGATGATAAAGCTGCCATTCAAGAAAAAATCATCATGGTAACTAAATCGATTAA
AGAACAAGGCTACAGCTCTCTATTAATCGATTTTGAAGAGGTACAAGATGATAATTAA