Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismPseudoalteromonas haloplanktis TAC125
GID1049
PID2049
Locus tagPSHAb0096
Locations113073..115031
Length1959 bp
G+C%37
Link NCBI: gi:77361923  
SequenceATGATAATTAAACAGCTCACCCTTGAAAATTTTGGTATTTATCAGGGTCGTCACGAAGTCAATTTAAGTA
CATCAGCAAATAAACCAATTATTCTTTTTGGTGGCTTAAATGGCGGTGGTAAAACAACCTTTTTAGATGC
GTTGCAACTTGTGCTTTACGGTAAGCATGCCAAATGCTCTAACCGAGGTCATCAGTCATATGGTAATTAT
TTAATAAGTACCAAAAATCGTTATGTGGGTAACGACGATACAGTTGAAATTTCACTAACGTTTACTCACA
CAACTGATACAACAACTAACGAGTTTGTTATTGTTCGAAGTTGGAAAACAAATACAAAAGACGTAAAAGA
TAAAGTTGTAGTTTATTGTAATCAACAAGAAGATTCTCATTTGAGCCAATACTGGGATGAGTTTGTAAAC
GAATTTATTCCACTTAGCTTATCTGATTTATTCTTTTTTGATGGCGAAAAAATAGAAAATTTAGCACACC
CAGACAGAAGTGCTGATTTAATTAAAACGGGTATAGAAAATCTACTTGGGCTTGACCTACTATCTCAGCT
GCAAATTGATTTAAATAATGTAGAGCGTAAACGTAAAAGTGAAAACCTAGATACAACCGTAGTAGCCAAA
GTAGAAGCTCTTGAAGCAGAAATAACTGAGCAAACAACTATTGTAACAGGTTTTAAAACTGATATTGCTA
ACTTAGAAAAACGTGCCAGTGATACTAACTTGAGTATTAATAAAGCCCGACAAAAAGTAAGAAGTGCAGG
CGCTCATTTAATTGAAGAGCGCGACATTATAAAGTTTGAACTCGGCGCAATTGAAGAAAAACTTAAAGCA
AATTTAGCCGAACGTGTAAAGCTAGATGCCGGATGCGGACCACTTGGTTTAATACCCAATTTAATATCAA
GCACAAAAGCCCAAATTAAAAAGGAAGAACAGGCAGTACAAGCGAACGTTATTCAAAGTGCTATTACAGA
GTACGAAGCCACAATTACGCAAACGCTAGTTAATGAAAACGTACCAGAAACCGCGCTTAGCGCACTCAGT
AATAAAATGGCTACCCTTGCCAAAGAACGCGAAGAACTAGCAAGCACAGAGTGTTATATTGCTAGTAACA
TCGCTATTTTTAATGGTCTTGATGAAAAAATAGCAAACGATAAGTTAGAGCGTTCAAACTTACTAAAAGC
TCGCGTAGAATTGTTTGAACAACAAGCGCTATTTAATAAAAAGCTTGAATCAATACCTGATTACGAAACT
GTTCAGCATTTACTTAGCGAACTAGCCGGGCTTGAAGTCGAGCTAAAAAACAGCTTTGTTTTAATAAAAC
AAAAACAGCAGTTGTTACAGCAAGCGCAAGCACGTGACGAAGTATTAAATACACGCTACGCAAACTTATT
AACCCAACAAAGCAAAGACACGTTTGAACAAAAACGCTCAATCCAAGTCGCGGATCATATTGGTAAGCTT
AAAAATACTATGAAGTCATTTGCCGATGAGCTAATACGTGAAAATGTAACAGGGCTTGAAGAGCACATTG
CCGCTAAGTTTTTTGACCTCTCTCGTAAAAACAACTTAATTACCGGTGTTAAAATTTGCCCTGATTCATT
CAAACTTACGTTACTCGATAACAATAAAAACCCAATGTCACCAAGCCGCTTATCGGCCGGTGAAAGGCAG
TTACTTGCTATAGCAATTTTATGGGGCTTAGCTGAAGCATCAGGCAAAGAAATCCCAACCGTTATCGATA
CACCACTTGGTCGCTTAGATGGAAAACATCGTAGTAAGCTTATTAATAACTACTTTCCTAAAGCATCAAG
CCAAGTGATTTTACTATCGACTGACGAAGAAATAACAGGGCAGTATTACACGCAATTAAAACCTGCAATT
TGCCGTGAATACCACATTAGTTACAACGAGCACGAACAAACCTCAACCTTTACTGAGGGGTACTTTTAA